EMAIL THIS PAGE TO A FRIEND

LAPTM5

lysosomal protein transmembrane 5

85 Gene Product Result for
Synonyms: CLAST6
UniProtKB ID: Q13571, Q13240, Q14698, Q3KP54
Gene ID:
Human(7805) Summary: This gene encodes a transmembrane receptor that is associated with lysosomes. The encoded protein, also known as E3 protein, may play a role in hematopoiesis. [provided by RefSeq, Feb 2009]
Mouse(16792) lysosomal-associated protein transmembrane 5
Rat(89783) lysosomal protein transmembrane 5
chicken(419552) lysosomal protein transmembrane 5
cow(512361) lysosomal protein transmembrane 5
domestic cat(101092870) lysosomal protein transmembrane 5
dog(487324) lysosomal protein transmembrane 5
domestic guinea pig(100714213) lysosomal protein transmembrane 5
naked mole-rat(101697987) lysosomal protein transmembrane 5
sheep(101121575) lysosomal protein transmembrane 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006762 Rosetta Predictions human pricing
NM_053538 Rosetta Predictions rat pricing
NM_010686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062155 predicted 1290
2 SASI_Hs01_00062156 predicted 1156
3 SASI_Hs01_00062157 predicted 566
4 SASI_Hs01_00062158 predicted 1292
5 SASI_Hs01_00062160 predicted 603
6 SASI_Hs01_00062161 predicted 662
7 SASI_Hs01_00062162 predicted 1293
8 SASI_Hs01_00062163 predicted 1309
9 SASI_Hs01_00062164 predicted 1161
10 SASI_Hs02_00342260 predicted 1180
11 SASI_Hs01_00062159 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052998 predicted 679
2 SASI_Rn01_00052999 predicted 498
3 SASI_Rn01_00053000 predicted 343
4 SASI_Rn01_00053001 predicted 1282
5 SASI_Rn01_00053002 predicted 778
6 SASI_Rn02_00266158 predicted 1017
7 SASI_Rn01_00053003 predicted 965
8 SASI_Rn01_00053004 predicted 1079
9 SASI_Rn02_00266159 predicted 1142
10 SASI_Rn01_00053005 predicted 771
11 SASI_Rn01_00053006 predicted 617
12 SASI_Rn01_00053007 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319124 predicted 1287
2 SASI_Mm01_00030923 predicted 649
3 SASI_Mm01_00030924 predicted 1283
4 SASI_Mm01_00030925 predicted 434
5 SASI_Mm02_00319125 predicted 587
6 SASI_Mm01_00030926 predicted 722
7 SASI_Mm01_00030927 predicted 1133
8 SASI_Mm01_00030928 predicted 558
9 SASI_Mm02_00319126 predicted 434
10 SASI_Mm01_00030929 predicted 508
11 SASI_Mm01_00030930 predicted 368
12 SASI_Mm01_00030931 predicted 1171
13 SASI_Mm01_00030932 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010686
LAPTM5 MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-786s21c1
Sequence:CCGGCCCATACTCAGAAGTGTGATCCTCGAGGATCACACTTCTGAGTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-729s21c1
Sequence:CCGGCTACGAGGAAGCCTTGTCTCTCTCGAGAGAGACAAGGCTTCCTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1179s21c1
Sequence:CCGGCGACAGGATGGGTCATGATTGCTCGAGCAATCATGACCCATCCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-663s1c1
Sequence:CCGGGAAGCACATGAATTCGGCCATCTCGAGATGGCCGAATTCATGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010686.2-2008s1c1
Sequence:CCGGGCTGTCCTTATCTTCAGTCAACTCGAGTTGACTGAAGATAAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-555s1c1
Sequence:CCGGGCACAGCCAGTTCATCAACATCTCGAGATGTTGATGAACTGGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-438s1c1
Sequence:CCGGGCTAGACTTCTGTTTGAGTATCTCGAGATACTCAAACAGAAGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-153s1c1
Sequence:CCGGCGGTAAAGTGTCCTGTAGGTTCTCGAGAACCTACAGGACACTTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1252s21c1
Sequence:CCGGCCTTCAAATAGCTTGCTTAAACTCGAGTTTAAGCAAGCTATTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010686
LAPTM5 MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-786s21c1
Sequence:CCGGCCCATACTCAGAAGTGTGATCCTCGAGGATCACACTTCTGAGTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-729s21c1
Sequence:CCGGCTACGAGGAAGCCTTGTCTCTCTCGAGAGAGACAAGGCTTCCTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1179s21c1
Sequence:CCGGCGACAGGATGGGTCATGATTGCTCGAGCAATCATGACCCATCCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-663s1c1
Sequence:CCGGGAAGCACATGAATTCGGCCATCTCGAGATGGCCGAATTCATGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010686.2-2008s1c1
Sequence:CCGGGCTGTCCTTATCTTCAGTCAACTCGAGTTGACTGAAGATAAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-555s1c1
Sequence:CCGGGCACAGCCAGTTCATCAACATCTCGAGATGTTGATGAACTGGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-438s1c1
Sequence:CCGGGCTAGACTTCTGTTTGAGTATCTCGAGATACTCAAACAGAAGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-153s1c1
Sequence:CCGGCGGTAAAGTGTCCTGTAGGTTCTCGAGAACCTACAGGACACTTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1252s21c1
Sequence:CCGGCCTTCAAATAGCTTGCTTAAACTCGAGTTTAAGCAAGCTATTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010686
LAPTM5 MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-786s21c1
Sequence:CCGGCCCATACTCAGAAGTGTGATCCTCGAGGATCACACTTCTGAGTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010686.3-729s21c1
Sequence:CCGGCTACGAGGAAGCCTTGTCTCTCTCGAGAGAGACAAGGCTTCCTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1179s21c1
Sequence:CCGGCGACAGGATGGGTCATGATTGCTCGAGCAATCATGACCCATCCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-663s1c1
Sequence:CCGGGAAGCACATGAATTCGGCCATCTCGAGATGGCCGAATTCATGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010686.2-2008s1c1
Sequence:CCGGGCTGTCCTTATCTTCAGTCAACTCGAGTTGACTGAAGATAAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-555s1c1
Sequence:CCGGGCACAGCCAGTTCATCAACATCTCGAGATGTTGATGAACTGGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-438s1c1
Sequence:CCGGGCTAGACTTCTGTTTGAGTATCTCGAGATACTCAAACAGAAGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010686.2-153s1c1
Sequence:CCGGCGGTAAAGTGTCCTGTAGGTTCTCGAGAACCTACAGGACACTTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010686.3-1252s21c1
Sequence:CCGGCCTTCAAATAGCTTGCTTAAACTCGAGTTTAAGCAAGCTATTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006762
LAPTM5 MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1053s21c1
Sequence:CCGGCACAACTGGGTCAACGCTTTACTCGAGTAAAGCGTTGACCCAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-328s21c1
Sequence:CCGGCCTACTGATCGGCGTAGTCAACTCGAGTTGACTACGCCGATCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1085s21c1
Sequence:CCGGTCCTCGGGTCTCTCCATAATTCTCGAGAATTATGGAGAGACCCGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006762.1-1614s1c1
Sequence:CCGGGCTCCAGGAAATAACAGTTATCTCGAGATAACTGTTATTTCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-612s1c1
Sequence:CCGGGCCTCATAACCAGTTCATCAACTCGAGTTGATGAACTGGTTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-705s1c1
Sequence:CCGGGCGGTGCTACAGATTGATCAACTCGAGTTGATCAATCTGTAGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-549s1c1
Sequence:CCGGGCCCACCTATCTCAACTTCAACTCGAGTTGAAGTTGAGATAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-615s1c1
Sequence:CCGGTCATAACCAGTTCATCAAGATCTCGAGATCTTGATGAACTGGTTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-174s21c1
Sequence:CCGGATGTGATCATGAGCGTCTTGTCTCGAGACAAGACGCTCATGATCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006762
LAPTM5 MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1053s21c1
Sequence:CCGGCACAACTGGGTCAACGCTTTACTCGAGTAAAGCGTTGACCCAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-328s21c1
Sequence:CCGGCCTACTGATCGGCGTAGTCAACTCGAGTTGACTACGCCGATCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1085s21c1
Sequence:CCGGTCCTCGGGTCTCTCCATAATTCTCGAGAATTATGGAGAGACCCGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006762.1-1614s1c1
Sequence:CCGGGCTCCAGGAAATAACAGTTATCTCGAGATAACTGTTATTTCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-612s1c1
Sequence:CCGGGCCTCATAACCAGTTCATCAACTCGAGTTGATGAACTGGTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-705s1c1
Sequence:CCGGGCGGTGCTACAGATTGATCAACTCGAGTTGATCAATCTGTAGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-549s1c1
Sequence:CCGGGCCCACCTATCTCAACTTCAACTCGAGTTGAAGTTGAGATAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-615s1c1
Sequence:CCGGTCATAACCAGTTCATCAAGATCTCGAGATCTTGATGAACTGGTTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-174s21c1
Sequence:CCGGATGTGATCATGAGCGTCTTGTCTCGAGACAAGACGCTCATGATCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006762
LAPTM5 MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1053s21c1
Sequence:CCGGCACAACTGGGTCAACGCTTTACTCGAGTAAAGCGTTGACCCAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-328s21c1
Sequence:CCGGCCTACTGATCGGCGTAGTCAACTCGAGTTGACTACGCCGATCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006762.2-1085s21c1
Sequence:CCGGTCCTCGGGTCTCTCCATAATTCTCGAGAATTATGGAGAGACCCGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006762.1-1614s1c1
Sequence:CCGGGCTCCAGGAAATAACAGTTATCTCGAGATAACTGTTATTTCCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-612s1c1
Sequence:CCGGGCCTCATAACCAGTTCATCAACTCGAGTTGATGAACTGGTTATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-705s1c1
Sequence:CCGGGCGGTGCTACAGATTGATCAACTCGAGTTGATCAATCTGTAGCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-549s1c1
Sequence:CCGGGCCCACCTATCTCAACTTCAACTCGAGTTGAAGTTGAGATAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006762.1-615s1c1
Sequence:CCGGTCATAACCAGTTCATCAAGATCTCGAGATCTTGATGAACTGGTTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006762.2-174s21c1
Sequence:CCGGATGTGATCATGAGCGTCTTGTCTCGAGACAAGACGCTCATGATCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)