EMAIL THIS PAGE TO A FRIEND

LARGE

like-glycosyltransferase

158 Gene Product Result for
Synonyms: MDC1D MDDGA6 MDDGB6
Gene ID:
Human(9215) Summary: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(16795) like-glycosyltransferase
Rat(361368) like-glycosyltransferase
Zebrafish(446213) like-glycosyltransferase
dog(474521) like-glycosyltransferase
chicken(418062) like-glycosyltransferase
domestic cat(101091463) like-glycosyltransferase
cow(506466) like-glycosyltransferase
Horse(100068935) like-glycosyltransferase
sheep(101120155) like-glycosyltransferase
Domestic Rabbit(100346008) like-glycosyltransferase
domestic guinea pig(100286788) like-glycosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004737 Rosetta Predictions human pricing
NM_133642 Rosetta Predictions human pricing
NM_001108439 Rosetta Predictions rat pricing
NM_010687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338219 predicted 1742
2 SASI_Hs01_00032739 predicted 1228
3 SASI_Hs01_00032740 predicted 1795
4 SASI_Hs01_00032741 predicted 1785
5 SASI_Hs01_00032742 predicted 2606
6 SASI_Hs01_00032743 predicted 1348
7 SASI_Hs01_00032744 predicted 1803
8 SASI_Hs01_00032745 predicted 2252
9 SASI_Hs01_00032746 predicted 1083
10 SASI_Hs01_00032747 predicted 2242
11 SASI_Hs01_00032748 predicted 2806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363283 predicted 1685
2 SASI_Hs01_00184462 predicted 1164
3 SASI_Hs01_00184463 predicted 1740
4 SASI_Hs01_00184464 predicted 1730
5 SASI_Hs01_00184465 predicted 2542
6 SASI_Hs01_00184466 predicted 1290
7 SASI_Hs01_00184467 predicted 1739
8 SASI_Hs01_00184468 predicted 2189
9 SASI_Hs01_00184469 predicted 1022
10 SASI_Hs01_00184470 predicted 2182
11 SASI_Hs01_00184471 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238649 predicted 1604
2 SASI_Rn02_00238650 predicted 1116
3 SASI_Rn02_00238651 predicted 1583
4 SASI_Rn02_00238652 predicted 1024
5 SASI_Rn02_00238653 predicted 971
6 SASI_Rn02_00238654 predicted 1104
7 SASI_Rn02_00238655 predicted 1345
8 SASI_Rn02_00238656 predicted 1723
9 SASI_Rn02_00238657 predicted 1250
10 SASI_Rn02_00238658 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159190 predicted 2169
2 SASI_Mm01_00159191 predicted 766
3 SASI_Mm01_00159192 predicted 1135
4 SASI_Mm01_00159193 predicted 2377
5 SASI_Mm01_00159194 predicted 682
6 SASI_Mm01_00159195 predicted 821
7 SASI_Mm02_00319127 predicted 1436
8 SASI_Mm02_00319128 predicted 247
9 SASI_Mm01_00159197 predicted 631
10 SASI_Mm01_00159198 predicted 2032
11 SASI_Mm01_00159196 predicted 2048
12 SASI_Mm01_00159199 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004737
VALIDATED
LARGE MISSION shRNA Bacterial Glycerol Stock
like-glycosyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1081s1c1
Sequence:CCGGCCACCTTATTGCTGACTCCATCTCGAGATGGAGTCAGCAATAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-2719s1c1
Sequence:CCGGGTTCCGTTCCAACAAGCAATACTCGAGTATTGCTTGTTGGAACGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1784s1c1
Sequence:CCGGCTGGAGTATGACGGCAATCTTCTCGAGAAGATTGCCGTCATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-964s1c1
Sequence:CCGGCGTGGAGAAATGCGAGACAATCTCGAGATTGTCTCGCATTTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1563s1c1
Sequence:CCGGCCTTAGCTGACCAGGATATTTCTCGAGAAATATCCTGGTCAGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004737
VALIDATED
LARGE MISSION shRNA shRNA Plasmid DNA
like-glycosyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1081s1c1
Sequence:CCGGCCACCTTATTGCTGACTCCATCTCGAGATGGAGTCAGCAATAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-2719s1c1
Sequence:CCGGGTTCCGTTCCAACAAGCAATACTCGAGTATTGCTTGTTGGAACGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1784s1c1
Sequence:CCGGCTGGAGTATGACGGCAATCTTCTCGAGAAGATTGCCGTCATACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-964s1c1
Sequence:CCGGCGTGGAGAAATGCGAGACAATCTCGAGATTGTCTCGCATTTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1563s1c1
Sequence:CCGGCCTTAGCTGACCAGGATATTTCTCGAGAAATATCCTGGTCAGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004737
VALIDATED
LARGE MISSION shRNA Lentiviral Transduction Particles
like-glycosyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1081s1c1
Sequence:CCGGCCACCTTATTGCTGACTCCATCTCGAGATGGAGTCAGCAATAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-2719s1c1
Sequence:CCGGGTTCCGTTCCAACAAGCAATACTCGAGTATTGCTTGTTGGAACGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1784s1c1
Sequence:CCGGCTGGAGTATGACGGCAATCTTCTCGAGAAGATTGCCGTCATACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-964s1c1
Sequence:CCGGCGTGGAGAAATGCGAGACAATCTCGAGATTGTCTCGCATTTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004737.2-1563s1c1
Sequence:CCGGCCTTAGCTGACCAGGATATTTCTCGAGAAATATCCTGGTCAGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010687
VALIDATED
LARGE MISSION shRNA Bacterial Glycerol Stock
like-glycosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2175s1c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2300s1c1
Sequence:CCGGCCCTAGTTTCGACATCACTAACTCGAGTTAGTGATGTCGAAACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2751s1c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010687.1-808s1c1
Sequence:CCGGCCAACAAACATTACTCTGGAACTCGAGTTCCAGAGTAATGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-683s1c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-753s21c1
Sequence:CCGGGTGCGAGTAGACTTCTATAATCTCGAGATTATAGAAGTCTACTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2175s21c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2751s21c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-683s21c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010687.1-598s21c1
Sequence:CCGGTCGTCTGTGCCGGATACAATGCTCGAGCATTGTATCCGGCACAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010687
VALIDATED
LARGE MISSION shRNA shRNA Plasmid DNA
like-glycosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2175s1c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2300s1c1
Sequence:CCGGCCCTAGTTTCGACATCACTAACTCGAGTTAGTGATGTCGAAACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2751s1c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010687.1-808s1c1
Sequence:CCGGCCAACAAACATTACTCTGGAACTCGAGTTCCAGAGTAATGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-683s1c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-753s21c1
Sequence:CCGGGTGCGAGTAGACTTCTATAATCTCGAGATTATAGAAGTCTACTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2175s21c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2751s21c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-683s21c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010687.1-598s21c1
Sequence:CCGGTCGTCTGTGCCGGATACAATGCTCGAGCATTGTATCCGGCACAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010687
VALIDATED
LARGE MISSION shRNA Lentiviral Transduction Particles
like-glycosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2175s1c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2300s1c1
Sequence:CCGGCCCTAGTTTCGACATCACTAACTCGAGTTAGTGATGTCGAAACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-2751s1c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010687.1-808s1c1
Sequence:CCGGCCAACAAACATTACTCTGGAACTCGAGTTCCAGAGTAATGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010687.1-683s1c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-753s21c1
Sequence:CCGGGTGCGAGTAGACTTCTATAATCTCGAGATTATAGAAGTCTACTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2175s21c1
Sequence:CCGGCCTGAGTATGATCGGAGATTTCTCGAGAAATCTCCGATCATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-2751s21c1
Sequence:CCGGCCTTAGCTGTTGAGAAAGTAACTCGAGTTACTTTCTCAACAGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010687.1-683s21c1
Sequence:CCGGCCACCTCATTGCTGATTCTATCTCGAGATAGAATCAGCAATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010687.1-598s21c1
Sequence:CCGGTCGTCTGTGCCGGATACAATGCTCGAGCATTGTATCCGGCACAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)