EMAIL THIS PAGE TO A FRIEND

LARP1

La ribonucleoprotein domain family, member 1

201 Gene Product Result for
Synonyms: LARP
UniProtKB ID: Q6PKG0, O94836, Q8N4M2, Q8NB73, Q9UFD7
Gene ID:
Mouse(73158) La ribonucleoprotein domain family, member 1
Rat(303158) La ribonucleoprotein domain family, member 1
Zebrafish(327175) La ribonucleoprotein domain family, member 1
chicken(416258) La ribonucleoprotein domain family, member 1
domestic cat(101096204) La ribonucleoprotein domain family, member 1
dog(612929) La ribonucleoprotein domain family, member 1
Horse(100071380) La ribonucleoprotein domain family, member 1
cow(505690) La ribonucleoprotein domain family, member 1
sheep(101112568) La ribonucleoprotein domain family, member 1
Domestic Rabbit(100350476) La ribonucleoprotein domain family, member 1
domestic guinea pig(100725400) La ribonucleoprotein domain family, member 1
naked mole-rat(101720343) La ribonucleoprotein domain family, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015315 Rosetta Predictions human pricing
NM_033551 Rosetta Predictions human pricing
XM_001075150 Rosetta Predictions rat pricing
XM_220446 Rosetta Predictions rat pricing
XM_126172 Rosetta Predictions mouse pricing
XM_905029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168468 predicted 1683
2 SASI_Hs01_00168469 predicted 437
3 SASI_Hs01_00168470 predicted 1875
4 SASI_Hs01_00168471 predicted 2817
5 SASI_Hs01_00168472 predicted 2162
6 SASI_Hs01_00168473 predicted 2683
7 SASI_Hs01_00168474 predicted 2341
8 SASI_Hs01_00168475 predicted 1445
9 SASI_Hs01_00168477 predicted 2611
10 SASI_Hs02_00347583 predicted 939
11 SASI_Hs01_00168476 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073381 predicted 2319
2 SASI_Hs01_00073382 predicted 1069
3 SASI_Hs01_00073383 predicted 2510
4 SASI_Hs01_00073384 predicted 3455
5 SASI_Hs01_00073385 predicted 2798
6 SASI_Hs01_00073386 predicted 3315
7 SASI_Hs01_00073387 predicted 2980
8 SASI_Hs01_00073388 predicted 2081
9 SASI_Hs01_00073390 predicted 3250
10 SASI_Hs02_00361427 predicted 1572
11 SASI_Hs01_00073389 predicted 1913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348676 predicted 2178
2 SASI_Rn02_00348677 predicted 2856
3 SASI_Rn02_00348678 predicted 2843
4 SASI_Rn02_00348679 predicted 765
5 SASI_Rn02_00348680 predicted 688
6 SASI_Rn02_00348681 predicted 305
7 SASI_Rn02_00348682 predicted 1759
8 SASI_Rn02_00348683 predicted 448
9 SASI_Rn02_00348684 predicted 961
10 SASI_Rn02_00348685 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379291 predicted 277
2 SASI_Rn02_00379292 predicted 2455
3 SASI_Rn02_00379293 predicted 3126
4 SASI_Rn02_00379294 predicted 3110
5 SASI_Rn02_00379295 predicted 1035
6 SASI_Rn02_00379296 predicted 957
7 SASI_Rn02_00379297 predicted 568
8 SASI_Rn02_00379298 predicted 2034
9 SASI_Rn02_00379299 predicted 1227
10 SASI_Rn02_00379300 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263580 predicted 2525
2 SASI_Mm01_00263581 predicted 1676
3 SASI_Mm01_00263582 predicted 3099
4 SASI_Mm01_00263583 predicted 1363
5 SASI_Mm01_00263585 predicted 1598
6 SASI_Mm01_00263586 predicted 1321
7 SASI_Mm01_00263587 predicted 1890
8 SASI_Mm01_00263588 predicted 3770
9 SASI_Mm01_00263589 predicted 2821
10 SASI_Mm02_00424140 predicted 3137
11 SASI_Mm01_00263584 predicted 3673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431418 predicted 718
2 SASI_Mm02_00431419 predicted 1944
3 SASI_Mm02_00431420 predicted 1093
4 SASI_Mm02_00431421 predicted 2509
5 SASI_Mm02_00431422 predicted 325
6 SASI_Mm02_00431423 predicted 773
7 SASI_Mm02_00431424 predicted 1012
8 SASI_Mm02_00431425 predicted 1309
9 SASI_Mm02_00431426 predicted 3188
10 SASI_Mm02_00431427 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028451
VALIDATED
LARP1 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3434s21c1
Sequence:CCGGGGACAGACCTAGAGTACTAAGCTCGAGCTTAGTACTCTAGGTCTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3094s21c1
Sequence:CCGGCAAGAATACCTCGGCAAATTCCTCGAGGAATTTGCCGAGGTATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3480s21c1
Sequence:CCGGTGTATACCATTTGGGCTATTACTCGAGTAATAGCCCAAATGGTATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028451.1-3319s21c1
Sequence:CCGGCACTCGGACACACTGACTTTGCTCGAGCAAAGTCAGTGTGTCCGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-2377s21c1
Sequence:CCGGGAGTCTCCAAACTACCGAAATCTCGAGATTTCGGTAGTTTGGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-1139s21c1
Sequence:CCGGAGTTTGGCTACCGAAAGTTTGCTCGAGCAAACTTTCGGTAGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-818s21c1
Sequence:CCGGTAGACATGAAGCCCGAAGTACCTCGAGGTACTTCGGGCTTCATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028451
VALIDATED
LARP1 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3434s21c1
Sequence:CCGGGGACAGACCTAGAGTACTAAGCTCGAGCTTAGTACTCTAGGTCTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3094s21c1
Sequence:CCGGCAAGAATACCTCGGCAAATTCCTCGAGGAATTTGCCGAGGTATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3480s21c1
Sequence:CCGGTGTATACCATTTGGGCTATTACTCGAGTAATAGCCCAAATGGTATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028451.1-3319s21c1
Sequence:CCGGCACTCGGACACACTGACTTTGCTCGAGCAAAGTCAGTGTGTCCGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-2377s21c1
Sequence:CCGGGAGTCTCCAAACTACCGAAATCTCGAGATTTCGGTAGTTTGGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-1139s21c1
Sequence:CCGGAGTTTGGCTACCGAAAGTTTGCTCGAGCAAACTTTCGGTAGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-818s21c1
Sequence:CCGGTAGACATGAAGCCCGAAGTACCTCGAGGTACTTCGGGCTTCATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028451
VALIDATED
LARP1 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3434s21c1
Sequence:CCGGGGACAGACCTAGAGTACTAAGCTCGAGCTTAGTACTCTAGGTCTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3094s21c1
Sequence:CCGGCAAGAATACCTCGGCAAATTCCTCGAGGAATTTGCCGAGGTATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-3480s21c1
Sequence:CCGGTGTATACCATTTGGGCTATTACTCGAGTAATAGCCCAAATGGTATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028451.1-3319s21c1
Sequence:CCGGCACTCGGACACACTGACTTTGCTCGAGCAAAGTCAGTGTGTCCGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-2377s21c1
Sequence:CCGGGAGTCTCCAAACTACCGAAATCTCGAGATTTCGGTAGTTTGGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-1139s21c1
Sequence:CCGGAGTTTGGCTACCGAAAGTTTGCTCGAGCAAACTTTCGGTAGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028451.1-818s21c1
Sequence:CCGGTAGACATGAAGCCCGAAGTACCTCGAGGTACTTCGGGCTTCATGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015315
VALIDATED
LARP1 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-3054s21c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015315.3-1017s21c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2826s21c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2694s21c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-1903s21c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-2619s1c1
Sequence:CCGGCGCCAAAGAAGGCTACAGATACTCGAGTATCTGTAGCCTTCTTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-262s1c1
Sequence:CCGGGCTGTTCCTAAACAGCGCAAACTCGAGTTTGCGCTGTTTAGGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-625s1c1
Sequence:CCGGCCTAGACACATACCTGCCAATCTCGAGATTGGCAGGTATGTGTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-3054s1c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1401s1c1
Sequence:CCGGCAACCTAAAGACACTACCCAACTCGAGTTGGGTAGTGTCTTTAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2826s1c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015315.2-2452s1c1
Sequence:CCGGCAACACGTCTACCATAAGTATCTCGAGATACTTATGGTAGACGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-1903s1c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2694s1c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1708s1c1
Sequence:CCGGGATGTCAACAAGATCCTCATTCTCGAGAATGAGGATCTTGTTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-1017s1c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-537s1c1
Sequence:CCGGCAAACACAAGTGGGTTCCATTCTCGAGAATGGAACCCACTTGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015315
VALIDATED
LARP1 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-3054s21c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015315.3-1017s21c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2826s21c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2694s21c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-1903s21c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-2619s1c1
Sequence:CCGGCGCCAAAGAAGGCTACAGATACTCGAGTATCTGTAGCCTTCTTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-262s1c1
Sequence:CCGGGCTGTTCCTAAACAGCGCAAACTCGAGTTTGCGCTGTTTAGGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-625s1c1
Sequence:CCGGCCTAGACACATACCTGCCAATCTCGAGATTGGCAGGTATGTGTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-3054s1c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1401s1c1
Sequence:CCGGCAACCTAAAGACACTACCCAACTCGAGTTGGGTAGTGTCTTTAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2826s1c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015315.2-2452s1c1
Sequence:CCGGCAACACGTCTACCATAAGTATCTCGAGATACTTATGGTAGACGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-1903s1c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2694s1c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1708s1c1
Sequence:CCGGGATGTCAACAAGATCCTCATTCTCGAGAATGAGGATCTTGTTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-1017s1c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-537s1c1
Sequence:CCGGCAAACACAAGTGGGTTCCATTCTCGAGAATGGAACCCACTTGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015315
VALIDATED
LARP1 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-3054s21c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015315.3-1017s21c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2826s21c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-2694s21c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015315.3-1903s21c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-2619s1c1
Sequence:CCGGCGCCAAAGAAGGCTACAGATACTCGAGTATCTGTAGCCTTCTTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-262s1c1
Sequence:CCGGGCTGTTCCTAAACAGCGCAAACTCGAGTTTGCGCTGTTTAGGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-625s1c1
Sequence:CCGGCCTAGACACATACCTGCCAATCTCGAGATTGGCAGGTATGTGTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-3054s1c1
Sequence:CCGGGCACTCGAACACACAGACTTTCTCGAGAAAGTCTGTGTGTTCGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1401s1c1
Sequence:CCGGCAACCTAAAGACACTACCCAACTCGAGTTGGGTAGTGTCTTTAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2826s1c1
Sequence:CCGGGCAAGAATACCTCGGCAAATTCTCGAGAATTTGCCGAGGTATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015315.2-2452s1c1
Sequence:CCGGCAACACGTCTACCATAAGTATCTCGAGATACTTATGGTAGACGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015315.2-1903s1c1
Sequence:CCGGCAAGAAGTCGAGAACTTCAAACTCGAGTTTGAAGTTCTCGACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-2694s1c1
Sequence:CCGGGCTGGACATATTCAAGGATTTCTCGAGAAATCCTTGAATATGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-1708s1c1
Sequence:CCGGGATGTCAACAAGATCCTCATTCTCGAGAATGAGGATCTTGTTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015315.2-1017s1c1
Sequence:CCGGGCGCCAGATTGAATACTACTTCTCGAGAAGTAGTATTCAATCTGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015315.2-537s1c1
Sequence:CCGGCAAACACAAGTGGGTTCCATTCTCGAGAATGGAACCCACTTGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)