EMAIL THIS PAGE TO A FRIEND

LARP1B

La ribonucleoprotein domain family, member 1B

188 Gene Product Result for
Synonyms: LARP2
Gene ID:
Human(55132) Summary: This gene encodes a protein containing domains found in the La related protein of Drosophila melanogaster. La motif-containing proteins are thought to be RNA-binding proteins, where the La motif and adjacent amino acids fold into an RNA recognition motif. The La motif is also found in proteins unrelated to the La protein. Alternative splicing has been observed at this locus and multiple variants, encoding distinct isoforms, are described. Additional splice variation has been identified but the full-length nature of these transcripts has not been determined. [provided by RefSeq, Jun 2013]
Mouse(214048) La ribonucleoprotein domain family, member 1B
Rat(310348) La ribonucleoprotein domain family, member 1B
domestic guinea pig(100725059) La ribonucleoprotein domain family, member 1B
naked mole-rat(101723742) La ribonucleoprotein domain family, member 1B
sheep(101120524) La ribonucleoprotein domain family, member 1B
Domestic Rabbit(100346995) La ribonucleoprotein domain family, member 1B
Zebrafish(568156) La ribonucleoprotein domain family, member 1B
chicken(422500) La ribonucleoprotein domain family, member 1B
Horse(100071865) La ribonucleoprotein domain family, member 1B
dog(476085) La ribonucleoprotein domain family, member 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018078 Rosetta Predictions human pricing
NM_032239 Rosetta Predictions human pricing
NM_178043 Rosetta Predictions human pricing
NM_001014036 Rosetta Predictions rat pricing
NM_001040399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072650 predicted 858
2 SASI_Hs01_00072651 predicted 778
3 SASI_Hs01_00072653 predicted 621
4 SASI_Hs01_00072654 predicted 483
5 SASI_Hs01_00072655 predicted 455
6 SASI_Hs01_00072656 predicted 791
7 SASI_Hs01_00072657 predicted 486
8 SASI_Hs01_00072658 predicted 700
9 SASI_Hs01_00072659 predicted 537
10 SASI_Hs02_00351230 predicted 520
11 SASI_Hs01_00072652 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039201 predicted 852
2 SASI_Hs01_00039202 predicted 779
3 SASI_Hs01_00039204 predicted 629
4 SASI_Hs01_00039205 predicted 481
5 SASI_Hs01_00039206 predicted 455
6 SASI_Hs01_00039207 predicted 789
7 SASI_Hs01_00039208 predicted 481
8 SASI_Hs01_00039209 predicted 694
9 SASI_Hs01_00039210 predicted 533
10 SASI_Hs02_00359549 predicted 519
11 SASI_Hs01_00039203 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014834 predicted 855
2 SASI_Hs01_00014835 predicted 776
3 SASI_Hs01_00014837 predicted 627
4 SASI_Hs01_00014838 predicted 476
5 SASI_Hs01_00014839 predicted 454
6 SASI_Hs01_00014840 predicted 790
7 SASI_Hs01_00014841 predicted 487
8 SASI_Hs01_00014842 predicted 698
9 SASI_Hs01_00014843 predicted 537
10 SASI_Hs02_00369523 predicted 527
11 SASI_Hs01_00014836 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201423 predicted 1124
2 SASI_Rn01_00051033 predicted 826
3 SASI_Rn01_00051034 predicted 487
4 SASI_Rn01_00051035 predicted 1153
5 SASI_Rn01_00051036 predicted 794
6 SASI_Rn01_00051037 predicted 768
7 SASI_Rn02_00201424 predicted 947
8 SASI_Rn02_00201425 predicted 932
9 SASI_Rn01_00051040 predicted 623
10 SASI_Rn01_00051041 predicted 1192
11 SASI_Rn01_00051038 predicted 875
12 SASI_Rn01_00051039 predicted 1163
13 SASI_Rn01_00051042 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172389 predicted 1047
2 SASI_Mm01_00172390 predicted 823
3 SASI_Mm01_00172391 predicted 812
4 SASI_Mm01_00172392 predicted 1152
5 SASI_Mm01_00172393 predicted 790
6 SASI_Mm01_00172394 predicted 938
7 SASI_Mm01_00172395 predicted 629
8 SASI_Mm01_00172396 predicted 928
9 SASI_Mm01_00172397 predicted 1047
10 SASI_Mm01_00172398 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018078
VALIDATED
LARP1B MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-369s1c1
Sequence:CCGGCCACTCCACTTAGATGTTGTACTCGAGTACAACATCTAAGTGGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-348s1c1
Sequence:CCGGGCTAATAAGCACAAGTGGGTACTCGAGTACCCACTTGTGCTTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2606s1c1
Sequence:CCGGGACACAGTCTATTGACCCAAACTCGAGTTTGGGTCAATAGACTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018078.2-3754s1c1
Sequence:CCGGGTATGTCATAAGGAGTCAGATCTCGAGATCTGACTCCTTATGACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-2255s1c1
Sequence:CCGGCCAACAAGTGTACCACAAGTACTCGAGTACTTGTGGTACACTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2742s1c1
Sequence:CCGGCGTCATAGACTTCCACCTAATCTCGAGATTAGGTGGAAGTCTATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-629s21c1
Sequence:CCGGTCGATTGAACTTTGATTATTCCTCGAGGAATAATCAAAGTTCAATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018078.2-2919s1c1
Sequence:CCGGGCCTGAGAAATAGACTCTTATCTCGAGATAAGAGTCTATTTCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-781s21c1
Sequence:CCGGAGTATATTAAGCGTCAAATTGCTCGAGCAATTTGACGCTTAATATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018078.2-3124s21c1
Sequence:CCGGTATAGAGATCTTCTAGTAATGCTCGAGCATTACTAGAAGATCTCTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-315s21c1
Sequence:CCGGGATGAGGCTCAGTCAAGTAATCTCGAGATTACTTGACTGAGCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-1412s21c1
Sequence:CCGGATTTACTGATTGGTCTGATAACTCGAGTTATCAGACCAATCAGTAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-542s21c1
Sequence:CCGGGAGAAGTGAGGGTGGTAATATCTCGAGATATTACCACCCTCACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018078
VALIDATED
LARP1B MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-369s1c1
Sequence:CCGGCCACTCCACTTAGATGTTGTACTCGAGTACAACATCTAAGTGGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-348s1c1
Sequence:CCGGGCTAATAAGCACAAGTGGGTACTCGAGTACCCACTTGTGCTTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2606s1c1
Sequence:CCGGGACACAGTCTATTGACCCAAACTCGAGTTTGGGTCAATAGACTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018078.2-3754s1c1
Sequence:CCGGGTATGTCATAAGGAGTCAGATCTCGAGATCTGACTCCTTATGACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-2255s1c1
Sequence:CCGGCCAACAAGTGTACCACAAGTACTCGAGTACTTGTGGTACACTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2742s1c1
Sequence:CCGGCGTCATAGACTTCCACCTAATCTCGAGATTAGGTGGAAGTCTATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-629s21c1
Sequence:CCGGTCGATTGAACTTTGATTATTCCTCGAGGAATAATCAAAGTTCAATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018078.2-2919s1c1
Sequence:CCGGGCCTGAGAAATAGACTCTTATCTCGAGATAAGAGTCTATTTCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-781s21c1
Sequence:CCGGAGTATATTAAGCGTCAAATTGCTCGAGCAATTTGACGCTTAATATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018078.2-3124s21c1
Sequence:CCGGTATAGAGATCTTCTAGTAATGCTCGAGCATTACTAGAAGATCTCTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-315s21c1
Sequence:CCGGGATGAGGCTCAGTCAAGTAATCTCGAGATTACTTGACTGAGCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-1412s21c1
Sequence:CCGGATTTACTGATTGGTCTGATAACTCGAGTTATCAGACCAATCAGTAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-542s21c1
Sequence:CCGGGAGAAGTGAGGGTGGTAATATCTCGAGATATTACCACCCTCACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018078
VALIDATED
LARP1B MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-369s1c1
Sequence:CCGGCCACTCCACTTAGATGTTGTACTCGAGTACAACATCTAAGTGGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-348s1c1
Sequence:CCGGGCTAATAAGCACAAGTGGGTACTCGAGTACCCACTTGTGCTTATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2606s1c1
Sequence:CCGGGACACAGTCTATTGACCCAAACTCGAGTTTGGGTCAATAGACTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018078.2-3754s1c1
Sequence:CCGGGTATGTCATAAGGAGTCAGATCTCGAGATCTGACTCCTTATGACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018078.2-2255s1c1
Sequence:CCGGCCAACAAGTGTACCACAAGTACTCGAGTACTTGTGGTACACTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018078.2-2742s1c1
Sequence:CCGGCGTCATAGACTTCCACCTAATCTCGAGATTAGGTGGAAGTCTATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-629s21c1
Sequence:CCGGTCGATTGAACTTTGATTATTCCTCGAGGAATAATCAAAGTTCAATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018078.2-2919s1c1
Sequence:CCGGGCCTGAGAAATAGACTCTTATCTCGAGATAAGAGTCTATTTCTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-781s21c1
Sequence:CCGGAGTATATTAAGCGTCAAATTGCTCGAGCAATTTGACGCTTAATATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018078.2-3124s21c1
Sequence:CCGGTATAGAGATCTTCTAGTAATGCTCGAGCATTACTAGAAGATCTCTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-315s21c1
Sequence:CCGGGATGAGGCTCAGTCAAGTAATCTCGAGATTACTTGACTGAGCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-1412s21c1
Sequence:CCGGATTTACTGATTGGTCTGATAACTCGAGTTATCAGACCAATCAGTAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018078.2-542s21c1
Sequence:CCGGGAGAAGTGAGGGTGGTAATATCTCGAGATATTACCACCCTCACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040399
LARP1B MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1B
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000216470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-953s1c1
Sequence:CCGGGGATAGCACAGAAGTAGAAATCTCGAGATTTCTACTTCTGTGCTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-834s1c1
Sequence:CCGGGACTTCTTTCTTCGAAGAAAGCTCGAGCTTTCTTCGAAGAAAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-780s1c1
Sequence:CCGGGAGTACATTAAGCGCCAAATTCTCGAGAATTTGGCGCTTAATGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040399
LARP1B MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1B
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000216470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-953s1c1
Sequence:CCGGGGATAGCACAGAAGTAGAAATCTCGAGATTTCTACTTCTGTGCTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-834s1c1
Sequence:CCGGGACTTCTTTCTTCGAAGAAAGCTCGAGCTTTCTTCGAAGAAAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-780s1c1
Sequence:CCGGGAGTACATTAAGCGCCAAATTCTCGAGAATTTGGCGCTTAATGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040399
LARP1B MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1B
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000216470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-953s1c1
Sequence:CCGGGGATAGCACAGAAGTAGAAATCTCGAGATTTCTACTTCTGTGCTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-834s1c1
Sequence:CCGGGACTTCTTTCTTCGAAGAAAGCTCGAGCTTTCTTCGAAGAAAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040399.1-780s1c1
Sequence:CCGGGAGTACATTAAGCGCCAAATTCTCGAGAATTTGGCGCTTAATGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145988
VALIDATED
LARP1B MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-102s1c1
Sequence:CCGGGAGTGTTATCAACCAAGGAAACTCGAGTTTCCTTGGTTGATAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-624s1c1
Sequence:CCGGGCTTAATACCAGCATGATGTACTCGAGTACATCATGCTGGTATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1120s1c1
Sequence:CCGGCCATGTAAATATGAGAGCAAACTCGAGTTTGCTCTCATATTTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1419s1c1
Sequence:CCGGGCCCAGATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145988.1-679s1c1
Sequence:CCGGCCTGTTGAAGAAACACTGCTTCTCGAGAAGCAGTGTTTCTTCAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-1035s1c1
Sequence:CCGGCCATACAGTCAGGGTGATGATCTCGAGATCATCACCCTGACTGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145988
VALIDATED
LARP1B MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-102s1c1
Sequence:CCGGGAGTGTTATCAACCAAGGAAACTCGAGTTTCCTTGGTTGATAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-624s1c1
Sequence:CCGGGCTTAATACCAGCATGATGTACTCGAGTACATCATGCTGGTATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1120s1c1
Sequence:CCGGCCATGTAAATATGAGAGCAAACTCGAGTTTGCTCTCATATTTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1419s1c1
Sequence:CCGGGCCCAGATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145988.1-679s1c1
Sequence:CCGGCCTGTTGAAGAAACACTGCTTCTCGAGAAGCAGTGTTTCTTCAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-1035s1c1
Sequence:CCGGCCATACAGTCAGGGTGATGATCTCGAGATCATCACCCTGACTGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145988
VALIDATED
LARP1B MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-102s1c1
Sequence:CCGGGAGTGTTATCAACCAAGGAAACTCGAGTTTCCTTGGTTGATAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-624s1c1
Sequence:CCGGGCTTAATACCAGCATGATGTACTCGAGTACATCATGCTGGTATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1120s1c1
Sequence:CCGGCCATGTAAATATGAGAGCAAACTCGAGTTTGCTCTCATATTTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145988.1-1419s1c1
Sequence:CCGGGCCCAGATCAATAAAGCAGAACTCGAGTTCTGCTTTATTGATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145988.1-679s1c1
Sequence:CCGGCCTGTTGAAGAAACACTGCTTCTCGAGAAGCAGTGTTTCTTCAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145988.1-1035s1c1
Sequence:CCGGCCATACAGTCAGGGTGATGATCTCGAGATCATCACCCTGACTGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)