EMAIL THIS PAGE TO A FRIEND

LARP1BP1

La ribonucleoprotein domain family, member 1B pseudogene 1

30 Gene Product Result for
Species: Human LARP1BP1(644578)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001715474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001715474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001715474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715474 Rosetta Predictions human pricing
XM_927694 Rosetta Predictions human pricing
XM_937192 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403959 predicted 345
2 SASI_Hs02_00403960 predicted 296
3 SASI_Hs02_00403961 predicted 291
4 SASI_Hs02_00403962 predicted 296
5 SASI_Hs02_00403963 predicted 300
6 SASI_Hs02_00403964 predicted 340
7 SASI_Hs02_00403965 predicted 233
8 SASI_Hs02_00403966 predicted 341
9 SASI_Hs02_00403967 predicted 495
10 SASI_Hs02_00403968 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480662 predicted 308
2 SASI_Hs02_00480663 predicted 254
3 SASI_Hs02_00480664 predicted 265
4 SASI_Hs02_00480665 predicted 264
5 SASI_Hs02_00480666 predicted 258
6 SASI_Hs02_00480667 predicted 313
7 SASI_Hs02_00480668 predicted 306
8 SASI_Hs02_00480669 predicted 461
9 SASI_Hs02_00480670 predicted 465
10 SASI_Hs02_00480671 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482475 predicted 314
2 SASI_Hs02_00482476 predicted 259
3 SASI_Hs02_00482477 predicted 264
4 SASI_Hs02_00482478 predicted 262
5 SASI_Hs02_00482479 predicted 267
6 SASI_Hs02_00482480 predicted 309
7 SASI_Hs02_00482481 predicted 312
8 SASI_Hs02_00482482 predicted 461
9 SASI_Hs02_00482483 predicted 464
10 SASI_Hs02_00482484 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001715474
LARP1BP1 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 1B pseudogene 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-751s21c1
Sequence:CCGGAGAGACTACTTTCTTCGAGGACTCGAGTCCTCGAAGAAAGTAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-345s21c1
Sequence:CCGGTAAGGGAAATCCCTGGAACAACTCGAGTTGTTCCAGGGATTTCCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-614s21c1
Sequence:CCGGGAGAAGAACTTAATACCAGTACTCGAGTACTGGTATTAAGTTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-803s21c1
Sequence:CCGGTCCTGATTGCTGGTTTCCAACCTCGAGGTTGGAAACCAGCAATCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001715474
LARP1BP1 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 1B pseudogene 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-751s21c1
Sequence:CCGGAGAGACTACTTTCTTCGAGGACTCGAGTCCTCGAAGAAAGTAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-345s21c1
Sequence:CCGGTAAGGGAAATCCCTGGAACAACTCGAGTTGTTCCAGGGATTTCCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-614s21c1
Sequence:CCGGGAGAAGAACTTAATACCAGTACTCGAGTACTGGTATTAAGTTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-803s21c1
Sequence:CCGGTCCTGATTGCTGGTTTCCAACCTCGAGGTTGGAAACCAGCAATCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001715474
LARP1BP1 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 1B pseudogene 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-751s21c1
Sequence:CCGGAGAGACTACTTTCTTCGAGGACTCGAGTCCTCGAAGAAAGTAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-345s21c1
Sequence:CCGGTAAGGGAAATCCCTGGAACAACTCGAGTTGTTCCAGGGATTTCCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-614s21c1
Sequence:CCGGGAGAAGAACTTAATACCAGTACTCGAGTACTGGTATTAAGTTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715474.1-803s21c1
Sequence:CCGGTCCTGATTGCTGGTTTCCAACCTCGAGGTTGGAAACCAGCAATCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)