EMAIL THIS PAGE TO A FRIEND

LARP4

La ribonucleoprotein domain family, member 4

270 Gene Product Result for
Gene ID:
Mouse(207214) La ribonucleoprotein domain family, member 4
chicken(426876) La ribonucleoprotein domain family, member 4
domestic cat(101094191) La ribonucleoprotein domain family, member 4
Horse(100052331) La ribonucleoprotein domain family, member 4
dog(477609) La ribonucleoprotein domain family, member 4
cow(539286) La ribonucleoprotein domain family, member 4
sheep(101118601) La ribonucleoprotein domain family, member 4
Domestic Rabbit(100344218) La ribonucleoprotein domain family, member 4
domestic guinea pig(100736241) La ribonucleoprotein domain family, member 4
naked mole-rat(101698330) La ribonucleoprotein domain family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052879 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052879 Rosetta Predictions human pricing
NM_199188 Rosetta Predictions human pricing
NM_199190 Rosetta Predictions human pricing
NM_001024526 Rosetta Predictions mouse pricing
NM_001080948 Rosetta Predictions mouse pricing
XM_994715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187286 predicted 1794
2 SASI_Hs01_00187287 predicted 558
3 SASI_Hs01_00187288 predicted 1564
4 SASI_Hs01_00187289 predicted 589
5 SASI_Hs01_00187290 predicted 2284
6 SASI_Hs02_00361590 predicted 1557
7 SASI_Hs01_00187292 predicted 1911
8 SASI_Hs01_00187293 predicted 1651
9 SASI_Hs01_00187294 predicted 2110
10 SASI_Hs01_00187295 predicted 1530
11 SASI_Hs01_00187291 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142285 predicted 1804
2 SASI_Hs01_00142286 predicted 575
3 SASI_Hs01_00142287 predicted 1589
4 SASI_Hs01_00142288 predicted 606
5 SASI_Hs01_00142289 predicted 2305
6 SASI_Hs02_00372647 predicted 1579
7 SASI_Hs01_00142291 predicted 1933
8 SASI_Hs01_00142292 predicted 1664
9 SASI_Hs01_00142293 predicted 2123
10 SASI_Hs01_00142294 predicted 1551
11 SASI_Hs01_00142290 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242970 predicted 1575
2 SASI_Hs01_00242971 predicted 557
3 SASI_Hs01_00242972 predicted 1356
4 SASI_Hs01_00242973 predicted 591
5 SASI_Hs01_00242974 predicted 2068
6 SASI_Hs02_00372650 predicted 1344
7 SASI_Hs01_00242976 predicted 1701
8 SASI_Hs01_00242977 predicted 1434
9 SASI_Hs01_00242978 predicted 1892
10 SASI_Hs01_00242979 predicted 1318
11 SASI_Hs01_00242975 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287605 predicted 595
2 SASI_Mm02_00287606 predicted 470
3 SASI_Mm02_00287607 predicted 497
4 SASI_Mm02_00287608 predicted 675
5 SASI_Mm02_00287609 predicted 764
6 SASI_Mm02_00287610 predicted 1116
7 SASI_Mm02_00287611 predicted 549
8 SASI_Mm02_00287612 predicted 1021
9 SASI_Mm02_00287613 predicted 1015
10 SASI_Mm02_00287614 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294115 predicted 599
2 SASI_Mm02_00294116 predicted 475
3 SASI_Mm02_00294117 predicted 494
4 SASI_Mm02_00294118 predicted 684
5 SASI_Mm02_00294119 predicted 761
6 SASI_Mm02_00294120 predicted 1117
7 SASI_Mm02_00294121 predicted 556
8 SASI_Mm02_00294122 predicted 1021
9 SASI_Mm02_00294123 predicted 1016
10 SASI_Mm02_00294124 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202367 predicted 600
2 SASI_Mm01_00202368 predicted 858
3 SASI_Mm01_00202369 predicted 449
4 SASI_Mm01_00202370 predicted 1216
5 SASI_Mm01_00202371 predicted 473
6 SASI_Mm01_00202372 predicted 656
7 SASI_Mm01_00202373 predicted 1124
8 SASI_Mm01_00202374 predicted 1480
9 SASI_Mm01_00202375 predicted 1109
10 SASI_Mm01_00202376 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052879
VALIDATED
LARP4 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-841s1c1
Sequence:CCGGGCACACAATAGCAACTGGTATCTCGAGATACCAGTTGCTATTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-6014s1c1
Sequence:CCGGCCTTTGAAATTCACCTGATTACTCGAGTAATCAGGTGAATTTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4394s1c1
Sequence:CCGGGCGTTGGATTTCAGAGAATAACTCGAGTTATTCTCTGAAATCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-724s1c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-2153s21c1
Sequence:CCGGCAAGGGCTAGTAAGGATTATTCTCGAGAATAATCCTTACTAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052879.3-2363s21c1
Sequence:CCGGACTTGAACTGTGGCTATATTGCTCGAGCAATATAGCCACAGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-724s21c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-2113s21c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4720s1c1
Sequence:CCGGGCCTCATTACATCTAATAGTTCTCGAGAACTATTAGATGTAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-1193s1c1
Sequence:CCGGGCTTTAATTCGCCAGGATCTTCTCGAGAAGATCCTGGCGAATTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-600s1c1
Sequence:CCGGCCCAATTTGGACAGTTGCCAACTCGAGTTGGCAACTGTCCAAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-2113s1c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-1197s21c1
Sequence:CCGGTAATTCGCCAGGATCTTATAACTCGAGTTATAAGATCCTGGCGAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052879
VALIDATED
LARP4 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-841s1c1
Sequence:CCGGGCACACAATAGCAACTGGTATCTCGAGATACCAGTTGCTATTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-6014s1c1
Sequence:CCGGCCTTTGAAATTCACCTGATTACTCGAGTAATCAGGTGAATTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4394s1c1
Sequence:CCGGGCGTTGGATTTCAGAGAATAACTCGAGTTATTCTCTGAAATCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-724s1c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-2153s21c1
Sequence:CCGGCAAGGGCTAGTAAGGATTATTCTCGAGAATAATCCTTACTAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052879.3-2363s21c1
Sequence:CCGGACTTGAACTGTGGCTATATTGCTCGAGCAATATAGCCACAGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-724s21c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-2113s21c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4720s1c1
Sequence:CCGGGCCTCATTACATCTAATAGTTCTCGAGAACTATTAGATGTAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-1193s1c1
Sequence:CCGGGCTTTAATTCGCCAGGATCTTCTCGAGAAGATCCTGGCGAATTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-600s1c1
Sequence:CCGGCCCAATTTGGACAGTTGCCAACTCGAGTTGGCAACTGTCCAAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-2113s1c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-1197s21c1
Sequence:CCGGTAATTCGCCAGGATCTTATAACTCGAGTTATAAGATCCTGGCGAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052879
VALIDATED
LARP4 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-841s1c1
Sequence:CCGGGCACACAATAGCAACTGGTATCTCGAGATACCAGTTGCTATTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-6014s1c1
Sequence:CCGGCCTTTGAAATTCACCTGATTACTCGAGTAATCAGGTGAATTTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4394s1c1
Sequence:CCGGGCGTTGGATTTCAGAGAATAACTCGAGTTATTCTCTGAAATCCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-724s1c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-2153s21c1
Sequence:CCGGCAAGGGCTAGTAAGGATTATTCTCGAGAATAATCCTTACTAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052879.3-2363s21c1
Sequence:CCGGACTTGAACTGTGGCTATATTGCTCGAGCAATATAGCCACAGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052879.3-724s21c1
Sequence:CCGGCCAAGTCATAAGCGTTGTATTCTCGAGAATACAACGCTTATGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-2113s21c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052879.3-4720s1c1
Sequence:CCGGGCCTCATTACATCTAATAGTTCTCGAGAACTATTAGATGTAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-1193s1c1
Sequence:CCGGGCTTTAATTCGCCAGGATCTTCTCGAGAAGATCCTGGCGAATTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052879.3-600s1c1
Sequence:CCGGCCCAATTTGGACAGTTGCCAACTCGAGTTGGCAACTGTCCAAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_052879.3-2113s1c1
Sequence:CCGGCCTGAGAACTCCGTTGAGAAACTCGAGTTTCTCAACGGAGTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052879.3-1197s21c1
Sequence:CCGGTAATTCGCCAGGATCTTATAACTCGAGTTATAAGATCCTGGCGAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024526
VALIDATED
LARP4 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024526.2-617s21c1
Sequence:CCGGGTGATCAGTTCGTCCCAATATCTCGAGATATTGGGACGAACTGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-754s21c1
Sequence:CCGGCCAAGTCATAAGCGATGTATTCTCGAGAATACATCGCTTATGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1010s21c1
Sequence:CCGGCTAAGAATGGTTATCGATTAACTCGAGTTAATCGATAACCATTCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024526.2-5768s21c1
Sequence:CCGGATGCTTGTGTTGGCAATATATCTCGAGATATATTGCCAACACAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1679s21c1
Sequence:CCGGGAATGTCTGATGTCGTTAAAGCTCGAGCTTTAACGACATCAGACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024526
VALIDATED
LARP4 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024526.2-617s21c1
Sequence:CCGGGTGATCAGTTCGTCCCAATATCTCGAGATATTGGGACGAACTGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-754s21c1
Sequence:CCGGCCAAGTCATAAGCGATGTATTCTCGAGAATACATCGCTTATGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1010s21c1
Sequence:CCGGCTAAGAATGGTTATCGATTAACTCGAGTTAATCGATAACCATTCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024526.2-5768s21c1
Sequence:CCGGATGCTTGTGTTGGCAATATATCTCGAGATATATTGCCAACACAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1679s21c1
Sequence:CCGGGAATGTCTGATGTCGTTAAAGCTCGAGCTTTAACGACATCAGACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024526
VALIDATED
LARP4 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024526.2-617s21c1
Sequence:CCGGGTGATCAGTTCGTCCCAATATCTCGAGATATTGGGACGAACTGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-754s21c1
Sequence:CCGGCCAAGTCATAAGCGATGTATTCTCGAGAATACATCGCTTATGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1010s21c1
Sequence:CCGGCTAAGAATGGTTATCGATTAACTCGAGTTAATCGATAACCATTCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024526.2-5768s21c1
Sequence:CCGGATGCTTGTGTTGGCAATATATCTCGAGATATATTGCCAACACAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024526.2-1679s21c1
Sequence:CCGGGAATGTCTGATGTCGTTAAAGCTCGAGCTTTAACGACATCAGACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)