EMAIL THIS PAGE TO A FRIEND

LARP4B

La ribonucleoprotein domain family, member 4B

163 Gene Product Result for
Synonyms: KIAA0217 LARP5
UniProtKB ID: Q92615, A7MD20, Q5T3R3, Q5T3R4, Q5T3R5, Q68CY4
Gene ID:
Human(23185) Summary: This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Mouse(217980) La ribonucleoprotein domain family, member 4B
Rat(307070) La ribonucleoprotein domain family, member 4B
domestic guinea pig(100720804) La ribonucleoprotein domain family, member 4B
naked mole-rat(101713971) La ribonucleoprotein domain family, member 4B
sheep(101112750) La ribonucleoprotein domain family, member 4B
Domestic Rabbit(100359254) La ribonucleoprotein domain family, member 4B
Zebrafish(563742) La ribonucleoprotein domain family, member 4B
chicken(420457) La ribonucleoprotein domain family, member 4B
domestic cat(101095267) La ribonucleoprotein domain family, member 4B
cow(505723) La ribonucleoprotein domain family, member 4B
dog(478022) La ribonucleoprotein domain family, member 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015155 Rosetta Predictions human pricing
NM_001107361 Rosetta Predictions rat pricing
NM_172585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205321 predicted 840
2 SASI_Hs01_00205322 predicted 583
3 SASI_Hs01_00205323 predicted 1348
4 SASI_Hs01_00205324 predicted 671
5 SASI_Hs01_00205325 predicted 786
6 SASI_Hs01_00205326 predicted 748
7 SASI_Hs01_00205327 predicted 800
8 SASI_Hs01_00205328 predicted 943
9 SASI_Hs01_00205329 predicted 1697
10 SASI_Hs02_00347112 predicted 1930
11 SASI_Hs01_00205330 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228065 predicted 391
2 SASI_Rn02_00228066 predicted 1202
3 SASI_Rn02_00228067 predicted 2235
4 SASI_Rn02_00228068 predicted 1612
5 SASI_Rn02_00228069 predicted 1014
6 SASI_Rn02_00228070 predicted 1104
7 SASI_Rn02_00228071 predicted 305
8 SASI_Rn02_00228072 predicted 902
9 SASI_Rn02_00228073 predicted 1525
10 SASI_Rn02_00228074 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140577 predicted 930
2 SASI_Mm01_00140578 predicted 1126
3 SASI_Mm01_00140579 predicted 884
4 SASI_Mm01_00140580 predicted 1632
5 SASI_Mm01_00140581 predicted 890
6 SASI_Mm01_00140582 predicted 318
7 SASI_Mm01_00140583 predicted 454
8 SASI_Mm02_00344265 predicted 1541
9 SASI_Mm01_00140585 predicted 538
10 SASI_Mm01_00140586 predicted 1426
11 SASI_Mm01_00140584 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015155
LARP4B MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1845s1c1
Sequence:CCGGCCAGCTCATTTACCCGATGATCTCGAGATCATCGGGTAAATGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-2011s1c1
Sequence:CCGGCGAGTAAAGAGCCTCCTTCTTCTCGAGAAGAAGGAGGCTCTTTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-748s1c1
Sequence:CCGGGCATAGTAATATTGCGTGAAACTCGAGTTTCACGCAATATTACTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1697s1c1
Sequence:CCGGCAGGCTATCTAGCTTGATAATCTCGAGATTATCAAGCTAGATAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015155.1-3336s1c1
Sequence:CCGGGCACTAAAGTTAGCAAGTTTACTCGAGTAAACTTGCTAACTTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015155.1-1997s1c1
Sequence:CCGGGATTTGTCAGAGAACGAGTAACTCGAGTTACTCGTTCTCTGACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-1266s21c1
Sequence:CCGGCGAAGCAGGAATCCTAGTAAACTCGAGTTTACTAGGATTCCTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-968s21c1
Sequence:CCGGAGCAAAGGCAATAGCTATAAACTCGAGTTTATAGCTATTGCCTTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015155.1-2574s21c1
Sequence:CCGGCTCTGAATGCAAGCTATATATCTCGAGATATATAGCTTGCATTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015155
LARP4B MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1845s1c1
Sequence:CCGGCCAGCTCATTTACCCGATGATCTCGAGATCATCGGGTAAATGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-2011s1c1
Sequence:CCGGCGAGTAAAGAGCCTCCTTCTTCTCGAGAAGAAGGAGGCTCTTTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-748s1c1
Sequence:CCGGGCATAGTAATATTGCGTGAAACTCGAGTTTCACGCAATATTACTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1697s1c1
Sequence:CCGGCAGGCTATCTAGCTTGATAATCTCGAGATTATCAAGCTAGATAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015155.1-3336s1c1
Sequence:CCGGGCACTAAAGTTAGCAAGTTTACTCGAGTAAACTTGCTAACTTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015155.1-1997s1c1
Sequence:CCGGGATTTGTCAGAGAACGAGTAACTCGAGTTACTCGTTCTCTGACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-1266s21c1
Sequence:CCGGCGAAGCAGGAATCCTAGTAAACTCGAGTTTACTAGGATTCCTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-968s21c1
Sequence:CCGGAGCAAAGGCAATAGCTATAAACTCGAGTTTATAGCTATTGCCTTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015155.1-2574s21c1
Sequence:CCGGCTCTGAATGCAAGCTATATATCTCGAGATATATAGCTTGCATTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015155
LARP4B MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1845s1c1
Sequence:CCGGCCAGCTCATTTACCCGATGATCTCGAGATCATCGGGTAAATGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-2011s1c1
Sequence:CCGGCGAGTAAAGAGCCTCCTTCTTCTCGAGAAGAAGGAGGCTCTTTACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-748s1c1
Sequence:CCGGGCATAGTAATATTGCGTGAAACTCGAGTTTCACGCAATATTACTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015155.1-1697s1c1
Sequence:CCGGCAGGCTATCTAGCTTGATAATCTCGAGATTATCAAGCTAGATAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015155.1-3336s1c1
Sequence:CCGGGCACTAAAGTTAGCAAGTTTACTCGAGTAAACTTGCTAACTTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015155.1-1997s1c1
Sequence:CCGGGATTTGTCAGAGAACGAGTAACTCGAGTTACTCGTTCTCTGACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-1266s21c1
Sequence:CCGGCGAAGCAGGAATCCTAGTAAACTCGAGTTTACTAGGATTCCTGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015155.1-968s21c1
Sequence:CCGGAGCAAAGGCAATAGCTATAAACTCGAGTTTATAGCTATTGCCTTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015155.1-2574s21c1
Sequence:CCGGCTCTGAATGCAAGCTATATATCTCGAGATATATAGCTTGCATTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172585
VALIDATED
LARP4B MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 4B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.1-1035s1c1
Sequence:CCGGCCAAATCAGAACCGGTGCATACTCGAGTATGCACCGGTTCTGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-495s1c1
Sequence:CCGGGTTTCAGAGCTAAACCCTAATCTCGAGATTAGGGTTTAGCTCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-960s1c1
Sequence:CCGGGATGTGGATTTGATTGTTGAACTCGAGTTCAACAATCAAATCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-1200s1c1
Sequence:CCGGCAGCAGGCTTACAAATACCTTCTCGAGAAGGTATTTGTAAGCCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-2311s1c1
Sequence:CCGGGAACGAGTAAAGACCCTTCTTCTCGAGAAGAAGGGTCTTTACTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172585.2-3085s1c1
Sequence:CCGGCAACAGGTAACTCTAGCTTTACTCGAGTAAAGCTAGAGTTACCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.2-390s1c1
Sequence:CCGGCATCTGATGAATGGTCCTATACTCGAGTATAGGACCATTCATCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172585
VALIDATED
LARP4B MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 4B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.1-1035s1c1
Sequence:CCGGCCAAATCAGAACCGGTGCATACTCGAGTATGCACCGGTTCTGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-495s1c1
Sequence:CCGGGTTTCAGAGCTAAACCCTAATCTCGAGATTAGGGTTTAGCTCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-960s1c1
Sequence:CCGGGATGTGGATTTGATTGTTGAACTCGAGTTCAACAATCAAATCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-1200s1c1
Sequence:CCGGCAGCAGGCTTACAAATACCTTCTCGAGAAGGTATTTGTAAGCCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-2311s1c1
Sequence:CCGGGAACGAGTAAAGACCCTTCTTCTCGAGAAGAAGGGTCTTTACTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172585.2-3085s1c1
Sequence:CCGGCAACAGGTAACTCTAGCTTTACTCGAGTAAAGCTAGAGTTACCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.2-390s1c1
Sequence:CCGGCATCTGATGAATGGTCCTATACTCGAGTATAGGACCATTCATCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172585
VALIDATED
LARP4B MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 4B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.1-1035s1c1
Sequence:CCGGCCAAATCAGAACCGGTGCATACTCGAGTATGCACCGGTTCTGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-495s1c1
Sequence:CCGGGTTTCAGAGCTAAACCCTAATCTCGAGATTAGGGTTTAGCTCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-960s1c1
Sequence:CCGGGATGTGGATTTGATTGTTGAACTCGAGTTCAACAATCAAATCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-1200s1c1
Sequence:CCGGCAGCAGGCTTACAAATACCTTCTCGAGAAGGTATTTGTAAGCCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172585.1-2311s1c1
Sequence:CCGGGAACGAGTAAAGACCCTTCTTCTCGAGAAGAAGGGTCTTTACTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172585.2-3085s1c1
Sequence:CCGGCAACAGGTAACTCTAGCTTTACTCGAGTAAAGCTAGAGTTACCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172585.2-390s1c1
Sequence:CCGGCATCTGATGAATGGTCCTATACTCGAGTATAGGACCATTCATCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)