EMAIL THIS PAGE TO A FRIEND

LARP6

La ribonucleoprotein domain family, member 6

67 Gene Product Result for
Synonyms: ACHN
UniProtKB ID: Q9BRS8, Q5XKE4, Q8N3N2, Q9NUR0
Gene ID:
Mouse(67557) La ribonucleoprotein domain family, member 6
Rat(315731) La ribonucleoprotein domain family, member 6
Zebrafish(334471) La ribonucleoprotein domain family, member 6
cow(787569) La ribonucleoprotein domain family, member 6
domestic cat(101097731) La ribonucleoprotein domain family, member 6
dog(487625) La ribonucleoprotein domain family, member 6
chicken(415392) La ribonucleoprotein domain family, member 6
sheep(101114526) La ribonucleoprotein domain family, member 6
domestic guinea pig(100734294) La ribonucleoprotein domain family, member 6
naked mole-rat(101696541) La ribonucleoprotein domain family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018357 Rosetta Predictions human pricing
NM_197958 Rosetta Predictions human pricing
NM_001108154 Rosetta Predictions rat pricing
NM_026235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153597 predicted 609
2 SASI_Hs01_00153598 predicted 1535
3 SASI_Hs02_00351818 predicted 1503
4 SASI_Hs01_00153599 predicted 1486
5 SASI_Hs01_00153600 predicted 429
6 SASI_Hs01_00153601 predicted 1298
7 SASI_Hs01_00153603 predicted 1310
8 SASI_Hs01_00153604 predicted 741
9 SASI_Hs01_00153605 predicted 623
10 SASI_Hs02_00351819 predicted 1058
11 SASI_Hs01_00153596 predicted 879
12 SASI_Hs01_00153602 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125096 predicted 381
2 SASI_Hs01_00125097 predicted 105
3 SASI_Hs01_00125098 predicted 103
4 SASI_Hs01_00125099 predicted 96
5 SASI_Hs01_00125100 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235884 predicted 769
2 SASI_Rn02_00235885 predicted 908
3 SASI_Rn02_00235886 predicted 1620
4 SASI_Rn02_00235887 predicted 890
5 SASI_Rn02_00235888 predicted 537
6 SASI_Rn02_00235889 predicted 848
7 SASI_Rn02_00235890 predicted 424
8 SASI_Rn02_00235891 predicted 728
9 SASI_Rn02_00235892 predicted 736
10 SASI_Rn02_00235893 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148675 predicted 1710
2 SASI_Mm01_00148676 predicted 1855
3 SASI_Mm01_00148677 predicted 880
4 SASI_Mm01_00148679 predicted 1800
5 SASI_Mm01_00148680 predicted 1785
6 SASI_Mm01_00148681 predicted 1018
7 SASI_Mm01_00148682 predicted 271
8 SASI_Mm01_00148683 predicted 1671
9 SASI_Mm01_00148684 predicted 855
10 SASI_Mm02_00329918 predicted 1782
11 SASI_Mm01_00148678 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026235
LARP6 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026235.4-1556s21c1
Sequence:CCGGTGTGTATAATGCCTTCTATTTCTCGAGAAATAGAAGGCATTATACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.4-992s1c1
Sequence:CCGGGATAAGAACCATGACGATGAGCTCGAGCTCATCGTCATGGTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1944s21c1
Sequence:CCGGGAGATGTGCTTTATGGTAAATCTCGAGATTTACCATAAAGCACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1887s21c1
Sequence:CCGGACAATGACTGAGCTGTCTTTGCTCGAGCAAAGACAGCTCAGTCATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-533s1c1
Sequence:CCGGGCACACGCCTTGAAGTATTCACTCGAGTGAATACTTCAAGGCGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-373s1c1
Sequence:CCGGGCTGGTGGATCAGATTGAGTTCTCGAGAACTCAATCTGATCCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-731s1c1
Sequence:CCGGGAGCATCTGCTCAAGCTCTTTCTCGAGAAAGAGCTTGAGCAGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-1593s1c1
Sequence:CCGGCCATCGGAAACCGTCTTTGTTCTCGAGAACAAAGACGGTTTCCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-2014s1c1
Sequence:CCGGCCCTGTCAAGTGAATAAATAACTCGAGTTATTTATTCACTTGACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-1335s1c1
Sequence:CCGGGCATGGATTATTCTTCCGACACTCGAGTGTCGGAAGAATAATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026235
LARP6 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026235.4-1556s21c1
Sequence:CCGGTGTGTATAATGCCTTCTATTTCTCGAGAAATAGAAGGCATTATACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.4-992s1c1
Sequence:CCGGGATAAGAACCATGACGATGAGCTCGAGCTCATCGTCATGGTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1944s21c1
Sequence:CCGGGAGATGTGCTTTATGGTAAATCTCGAGATTTACCATAAAGCACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1887s21c1
Sequence:CCGGACAATGACTGAGCTGTCTTTGCTCGAGCAAAGACAGCTCAGTCATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-533s1c1
Sequence:CCGGGCACACGCCTTGAAGTATTCACTCGAGTGAATACTTCAAGGCGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-373s1c1
Sequence:CCGGGCTGGTGGATCAGATTGAGTTCTCGAGAACTCAATCTGATCCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-731s1c1
Sequence:CCGGGAGCATCTGCTCAAGCTCTTTCTCGAGAAAGAGCTTGAGCAGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-1593s1c1
Sequence:CCGGCCATCGGAAACCGTCTTTGTTCTCGAGAACAAAGACGGTTTCCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-2014s1c1
Sequence:CCGGCCCTGTCAAGTGAATAAATAACTCGAGTTATTTATTCACTTGACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-1335s1c1
Sequence:CCGGGCATGGATTATTCTTCCGACACTCGAGTGTCGGAAGAATAATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026235
LARP6 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026235.4-1556s21c1
Sequence:CCGGTGTGTATAATGCCTTCTATTTCTCGAGAAATAGAAGGCATTATACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.4-992s1c1
Sequence:CCGGGATAAGAACCATGACGATGAGCTCGAGCTCATCGTCATGGTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1944s21c1
Sequence:CCGGGAGATGTGCTTTATGGTAAATCTCGAGATTTACCATAAAGCACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026235.4-1887s21c1
Sequence:CCGGACAATGACTGAGCTGTCTTTGCTCGAGCAAAGACAGCTCAGTCATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-533s1c1
Sequence:CCGGGCACACGCCTTGAAGTATTCACTCGAGTGAATACTTCAAGGCGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026235.2-373s1c1
Sequence:CCGGGCTGGTGGATCAGATTGAGTTCTCGAGAACTCAATCTGATCCACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-731s1c1
Sequence:CCGGGAGCATCTGCTCAAGCTCTTTCTCGAGAAAGAGCTTGAGCAGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-1593s1c1
Sequence:CCGGCCATCGGAAACCGTCTTTGTTCTCGAGAACAAAGACGGTTTCCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026235.2-2014s1c1
Sequence:CCGGCCCTGTCAAGTGAATAAATAACTCGAGTTATTTATTCACTTGACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026235.2-1335s1c1
Sequence:CCGGGCATGGATTATTCTTCCGACACTCGAGTGTCGGAAGAATAATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018357
VALIDATED
LARP6 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1312s21c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018357.2-1865s21c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1165s21c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-455s21c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-514s1c1
Sequence:CCGGCAGCACATGCTTTGAAGTATTCTCGAGAATACTTCAAAGCATGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-516s1c1
Sequence:CCGGGCACATGCTTTGAAGTATTCACTCGAGTGAATACTTCAAAGCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1312s1c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-941s1c1
Sequence:CCGGGATTGGTATGAAGCCACCCAACTCGAGTTGGGTGGCTTCATACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-1865s1c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-923s1c1
Sequence:CCGGGAACATGAAAGCTGTCCTGATCTCGAGATCAGGACAGCTTTCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1494s1c1
Sequence:CCGGCCTGACAACACCAGAGGATTTCTCGAGAAATCCTCTGGTGTTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-1165s1c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-899s1c1
Sequence:CCGGGATCACAGAATCTCAGGGCAACTCGAGTTGCCCTGAGATTCTGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-455s1c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018357
VALIDATED
LARP6 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1312s21c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018357.2-1865s21c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1165s21c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-455s21c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-514s1c1
Sequence:CCGGCAGCACATGCTTTGAAGTATTCTCGAGAATACTTCAAAGCATGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-516s1c1
Sequence:CCGGGCACATGCTTTGAAGTATTCACTCGAGTGAATACTTCAAAGCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1312s1c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-941s1c1
Sequence:CCGGGATTGGTATGAAGCCACCCAACTCGAGTTGGGTGGCTTCATACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-1865s1c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-923s1c1
Sequence:CCGGGAACATGAAAGCTGTCCTGATCTCGAGATCAGGACAGCTTTCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1494s1c1
Sequence:CCGGCCTGACAACACCAGAGGATTTCTCGAGAAATCCTCTGGTGTTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-1165s1c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-899s1c1
Sequence:CCGGGATCACAGAATCTCAGGGCAACTCGAGTTGCCCTGAGATTCTGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-455s1c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018357
VALIDATED
LARP6 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1312s21c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018357.2-1865s21c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-1165s21c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018357.2-455s21c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-514s1c1
Sequence:CCGGCAGCACATGCTTTGAAGTATTCTCGAGAATACTTCAAAGCATGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-516s1c1
Sequence:CCGGGCACATGCTTTGAAGTATTCACTCGAGTGAATACTTCAAAGCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1312s1c1
Sequence:CCGGGCAAGTGTATGGATTATTCCTCTCGAGAGGAATAATCCATACACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-941s1c1
Sequence:CCGGGATTGGTATGAAGCCACCCAACTCGAGTTGGGTGGCTTCATACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-1865s1c1
Sequence:CCGGCTCTCTTCTTTGGTATGGAATCTCGAGATTCCATACCAAAGAAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018357.2-923s1c1
Sequence:CCGGGAACATGAAAGCTGTCCTGATCTCGAGATCAGGACAGCTTTCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-1494s1c1
Sequence:CCGGCCTGACAACACCAGAGGATTTCTCGAGAAATCCTCTGGTGTTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-1165s1c1
Sequence:CCGGGCCACCAGAATCTCTTTCTGACTCGAGTCAGAAAGAGATTCTGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018357.2-899s1c1
Sequence:CCGGGATCACAGAATCTCAGGGCAACTCGAGTTGCCCTGAGATTCTGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018357.2-455s1c1
Sequence:CCGGCGTTAAGCTACTCACATCCTTCTCGAGAAGGATGTGAGTAGCTTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)