EMAIL THIS PAGE TO A FRIEND

LARS2

leucyl-tRNA synthetase 2, mitochondrial

57 Gene Product Result for
Synonyms: LEURS PRLTS4
UniProtKB ID: Q15031
Gene ID:
Human(23395) Summary: This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Mouse(102436) leucyl-tRNA synthetase, mitochondrial
Rat(363172) leucyl-tRNA synthetase 2, mitochondrial
Zebrafish(100126021) leucyl-tRNA synthetase 2, mitochondrial
cow(504609) leucyl-tRNA synthetase 2, mitochondrial
Horse(100054602) leucyl-tRNA synthetase 2, mitochondrial
domestic cat(101082473) leucyl-tRNA synthetase 2, mitochondrial
dog(476652) leucyl-tRNA synthetase 2, mitochondrial
chicken(420702) leucyl-tRNA synthetase 2, mitochondrial
sheep(101119512) leucyl-tRNA synthetase 2, mitochondrial
Domestic Rabbit(100358356) leucyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100714244) leucyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101699853) leucyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015340 Rosetta Predictions human pricing
NM_001108787 Rosetta Predictions rat pricing
NM_153168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079824 predicted 1888
2 SASI_Hs01_00079825 predicted 277
3 SASI_Hs02_00347646 predicted 342
4 SASI_Hs01_00079826 predicted 488
5 SASI_Hs01_00079827 predicted 1490
6 SASI_Hs01_00079828 predicted 2092
7 SASI_Hs01_00079829 predicted 2274
8 SASI_Hs01_00079830 predicted 1220
9 SASI_Hs01_00079831 predicted 1739
10 SASI_Hs01_00079832 predicted 285
11 SASI_Hs01_00079833 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242065 predicted 1526
2 SASI_Rn02_00242066 predicted 974
3 SASI_Rn02_00242067 predicted 719
4 SASI_Rn02_00242068 predicted 1952
5 SASI_Rn02_00242069 predicted 610
6 SASI_Rn02_00242070 predicted 2581
7 SASI_Rn02_00242071 predicted 1703
8 SASI_Rn02_00242072 predicted 1881
9 SASI_Rn02_00242073 predicted 1676
10 SASI_Rn02_00242074 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343087 predicted 1190
2 SASI_Mm02_00343088 predicted 2147
3 SASI_Mm02_00343089 predicted 829
4 SASI_Mm02_00343090 predicted 702
5 SASI_Mm02_00343091 predicted 2560
6 SASI_Mm02_00343092 predicted 423
7 SASI_Mm02_00343093 predicted 1988
8 SASI_Mm02_00343094 predicted 1749
9 SASI_Mm02_00343095 predicted 1889
10 SASI_Mm02_00343096 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153168
VALIDATED
LARS2 MISSION shRNA Bacterial Glycerol Stock
leucyl-tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2606s21c1
Sequence:CCGGGCAAGCTCTGTGACCATTATGCTCGAGCATAATGGTCACAGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2015s21c1
Sequence:CCGGGTCTGAAGAAGGAGGATATAGCTCGAGCTATATCCTCCTTCTTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-532s21c1
Sequence:CCGGATGAGAGGCATGCAGGTTATCCTCGAGGATAACCTGCATGCCTCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-3249s1c1
Sequence:CCGGCCTATCATTGTGAAGCAGAATCTCGAGATTCTGCTTCACAATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-961s1c1
Sequence:CCGGCCAGAGTGGTACGGAATCAAACTCGAGTTTGATTCCGTACCACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-1497s1c1
Sequence:CCGGCGTGACAAGTAACAAGCTGAACTCGAGTTCAGCTTGTTACTTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153168.1-1973s1c1
Sequence:CCGGGCCTCATTAAGGGACAGACATCTCGAGATGTCTGTCCCTTAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-2560s1c1
Sequence:CCGGCCTCATGTAACCTCAGAACTTCTCGAGAAGTTCTGAGGTTACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153168
VALIDATED
LARS2 MISSION shRNA shRNA Plasmid DNA
leucyl-tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2606s21c1
Sequence:CCGGGCAAGCTCTGTGACCATTATGCTCGAGCATAATGGTCACAGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2015s21c1
Sequence:CCGGGTCTGAAGAAGGAGGATATAGCTCGAGCTATATCCTCCTTCTTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-532s21c1
Sequence:CCGGATGAGAGGCATGCAGGTTATCCTCGAGGATAACCTGCATGCCTCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-3249s1c1
Sequence:CCGGCCTATCATTGTGAAGCAGAATCTCGAGATTCTGCTTCACAATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-961s1c1
Sequence:CCGGCCAGAGTGGTACGGAATCAAACTCGAGTTTGATTCCGTACCACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-1497s1c1
Sequence:CCGGCGTGACAAGTAACAAGCTGAACTCGAGTTCAGCTTGTTACTTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153168.1-1973s1c1
Sequence:CCGGGCCTCATTAAGGGACAGACATCTCGAGATGTCTGTCCCTTAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-2560s1c1
Sequence:CCGGCCTCATGTAACCTCAGAACTTCTCGAGAAGTTCTGAGGTTACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153168
VALIDATED
LARS2 MISSION shRNA Lentiviral Transduction Particles
leucyl-tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2606s21c1
Sequence:CCGGGCAAGCTCTGTGACCATTATGCTCGAGCATAATGGTCACAGAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-2015s21c1
Sequence:CCGGGTCTGAAGAAGGAGGATATAGCTCGAGCTATATCCTCCTTCTTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153168.2-532s21c1
Sequence:CCGGATGAGAGGCATGCAGGTTATCCTCGAGGATAACCTGCATGCCTCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-3249s1c1
Sequence:CCGGCCTATCATTGTGAAGCAGAATCTCGAGATTCTGCTTCACAATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-961s1c1
Sequence:CCGGCCAGAGTGGTACGGAATCAAACTCGAGTTTGATTCCGTACCACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-1497s1c1
Sequence:CCGGCGTGACAAGTAACAAGCTGAACTCGAGTTCAGCTTGTTACTTGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153168.1-1973s1c1
Sequence:CCGGGCCTCATTAAGGGACAGACATCTCGAGATGTCTGTCCCTTAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153168.1-2560s1c1
Sequence:CCGGCCTCATGTAACCTCAGAACTTCTCGAGAAGTTCTGAGGTTACATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015340
VALIDATED
LARS2 MISSION shRNA Bacterial Glycerol Stock
leucyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-1246s21c1
Sequence:CCGGAGGAGGTCCCTGTCGTTATTTCTCGAGAAATAACGACAGGGACCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-1362s1c1
Sequence:CCGGGCCTACTCTGAAGTCATTGAACTCGAGTTCAATGACTTCAGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-1875s1c1
Sequence:CCGGGCCGTCATGCACTTGTTCTATCTCGAGATAGAACAAGTGCATGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-287s1c1
Sequence:CCGGCGGATGTACCAGAAGCATCTACTCGAGTAGATGCTTCTGGTACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-896s1c1
Sequence:CCGGCCTCAGACAATGGTTTATTAACTCGAGTTAATAAACCATTGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-2561s1c1
Sequence:CCGGCCCTCATGTAACCTCAGAGATCTCGAGATCTCTGAGGTTACATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-2274s21c1
Sequence:CCGGACCTTGACAACTCGGTTTATTCTCGAGAATAAACCGAGTTGTCAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015340
VALIDATED
LARS2 MISSION shRNA shRNA Plasmid DNA
leucyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-1246s21c1
Sequence:CCGGAGGAGGTCCCTGTCGTTATTTCTCGAGAAATAACGACAGGGACCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-1362s1c1
Sequence:CCGGGCCTACTCTGAAGTCATTGAACTCGAGTTCAATGACTTCAGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-1875s1c1
Sequence:CCGGGCCGTCATGCACTTGTTCTATCTCGAGATAGAACAAGTGCATGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-287s1c1
Sequence:CCGGCGGATGTACCAGAAGCATCTACTCGAGTAGATGCTTCTGGTACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-896s1c1
Sequence:CCGGCCTCAGACAATGGTTTATTAACTCGAGTTAATAAACCATTGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-2561s1c1
Sequence:CCGGCCCTCATGTAACCTCAGAGATCTCGAGATCTCTGAGGTTACATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-2274s21c1
Sequence:CCGGACCTTGACAACTCGGTTTATTCTCGAGAATAAACCGAGTTGTCAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015340
VALIDATED
LARS2 MISSION shRNA Lentiviral Transduction Particles
leucyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-1246s21c1
Sequence:CCGGAGGAGGTCCCTGTCGTTATTTCTCGAGAAATAACGACAGGGACCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-1362s1c1
Sequence:CCGGGCCTACTCTGAAGTCATTGAACTCGAGTTCAATGACTTCAGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-1875s1c1
Sequence:CCGGGCCGTCATGCACTTGTTCTATCTCGAGATAGAACAAGTGCATGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015340.3-287s1c1
Sequence:CCGGCGGATGTACCAGAAGCATCTACTCGAGTAGATGCTTCTGGTACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-896s1c1
Sequence:CCGGCCTCAGACAATGGTTTATTAACTCGAGTTAATAAACCATTGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015340.3-2561s1c1
Sequence:CCGGCCCTCATGTAACCTCAGAGATCTCGAGATCTCTGAGGTTACATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015340.3-2274s21c1
Sequence:CCGGACCTTGACAACTCGGTTTATTCTCGAGAATAAACCGAGTTGTCAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)