EMAIL THIS PAGE TO A FRIEND

LARS

leucyl-tRNA synthetase

124 Gene Product Result for
Synonyms: HSPC192 LARS1 LEURS LEUS LRS PIG44 RNTLS hr025Cl
UniProtKB ID: Q9P2J5, A7E266, Q9NSE1
Gene ID:
Human(51520) Summary: This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. Alternatively spliced transcript variants of this gene have been found; however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(107045) leucyl-tRNA synthetase
Rat(291624) leucyl-tRNA synthetase
domestic guinea pig(100730224) leucyl-tRNA synthetase
naked mole-rat(101697750) leucyl-tRNA synthetase
sheep(101112134) leucyl-tRNA synthetase
Domestic Rabbit(100359202) leucyl-tRNA synthetase
chicken(416347) leucyl-tRNA synthetase
cow(509429) leucyl-tRNA synthetase
Horse(100061092) leucyl-tRNA synthetase
domestic cat(101083060) leucyl-tRNA synthetase
dog(478051) leucyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020117 Rosetta Predictions human pricing
NM_001009637 Rosetta Predictions rat pricing
NM_134137 Rosetta Predictions mouse pricing
XM_619533 Rosetta Predictions mouse pricing
XM_901168 Rosetta Predictions mouse pricing
XM_901173 Rosetta Predictions mouse pricing
XM_901177 Rosetta Predictions mouse pricing
XM_901182 Rosetta Predictions mouse pricing
XM_901187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017014 predicted 3309
2 SASI_Hs01_00017015 predicted 2770
3 SASI_Hs01_00017017 predicted 2522
4 SASI_Hs02_00352976 predicted 2869
5 SASI_Hs01_00017019 predicted 731
6 SASI_Hs01_00017020 predicted 1234
7 SASI_Hs01_00017021 predicted 3316
8 SASI_Hs02_00352977 predicted 3516
9 SASI_Hs01_00017023 predicted 1770
10 SASI_Hs02_00352978 predicted 1333
11 SASI_Hs01_00017016 predicted 338
12 SASI_Hs01_00017018 predicted 2903
13 SASI_Hs01_00017022 predicted 2949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102531 predicted 555
2 SASI_Rn01_00102532 predicted 2825
3 SASI_Rn01_00102533 predicted 1222
4 SASI_Rn01_00102534 predicted 3379
5 SASI_Rn01_00102536 predicted 3185
6 SASI_Rn01_00102537 predicted 319
7 SASI_Rn02_00199653 predicted 2004
8 SASI_Rn02_00199654 predicted 2220
9 SASI_Rn02_00199655 predicted 1070
10 SASI_Rn02_00199656 predicted 2566
11 SASI_Rn01_00102529 predicted 394
12 SASI_Rn01_00102530 predicted 1816
13 SASI_Rn01_00102535 predicted 1072
14 SASI_Rn01_00102538 predicted 2521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339389 predicted 3077
2 SASI_Mm02_00339390 predicted 1895
3 SASI_Mm02_00339391 predicted 313
4 SASI_Mm02_00339392 predicted 2669
5 SASI_Mm02_00339393 predicted 2993
6 SASI_Mm02_00339394 predicted 2830
7 SASI_Mm02_00339395 predicted 2825
8 SASI_Mm02_00339396 predicted 730
9 SASI_Mm02_00339397 predicted 571
10 SASI_Mm02_00339398 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269525 predicted 1165
2 SASI_Mm01_00269526 predicted 1966
3 SASI_Mm01_00269527 predicted 786
4 SASI_Mm01_00269528 predicted 2317
5 SASI_Mm01_00269529 predicted 696
6 SASI_Mm01_00269530 predicted 1562
7 SASI_Mm01_00269531 predicted 1890
8 SASI_Mm01_00269532 predicted 930
9 SASI_Mm01_00269533 predicted 1934
10 SASI_Mm01_00269534 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281909 predicted 363
2 SASI_Mm01_00281910 predicted 358
3 SASI_Mm01_00281911 predicted 437
4 SASI_Mm01_00281912 predicted 405
5 SASI_Mm01_00281913 predicted 598
6 SASI_Mm01_00281914 predicted 383
7 SASI_Mm01_00281915 predicted 481
8 SASI_Mm01_00281916 predicted 488
9 SASI_Mm01_00281917 predicted 689
10 SASI_Mm01_00281918 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229651 predicted 589
2 SASI_Mm01_00229652 predicted 423
3 SASI_Mm01_00229653 predicted 466
4 SASI_Mm01_00229654 predicted 557
5 SASI_Mm01_00229655 predicted 459
6 SASI_Mm01_00229656 predicted 814
7 SASI_Mm01_00229657 predicted 693
8 SASI_Mm01_00229658 predicted 386
9 SASI_Mm01_00229659 predicted 389
10 SASI_Mm01_00229660 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211919 predicted 1111
2 SASI_Mm01_00211920 predicted 1904
3 SASI_Mm01_00211921 predicted 783
4 SASI_Mm01_00211922 predicted 2256
5 SASI_Mm01_00211923 predicted 701
6 SASI_Mm01_00211924 predicted 1498
7 SASI_Mm01_00211925 predicted 1830
8 SASI_Mm01_00211926 predicted 1872
9 SASI_Mm01_00211927 predicted 963
10 SASI_Mm01_00211928 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213793 predicted 209
2 SASI_Mm01_00213794 predicted 280
3 SASI_Mm01_00213795 predicted 181
4 SASI_Mm01_00213796 predicted 228
5 SASI_Mm01_00213797 predicted 177
6 SASI_Mm01_00213798 predicted 278
7 SASI_Mm01_00213799 predicted 286
8 SASI_Mm01_00213800 predicted 211
9 SASI_Mm01_00213801 predicted 167
10 SASI_Mm01_00213802 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265826 predicted 455
2 SASI_Mm01_00265827 predicted 817
3 SASI_Mm01_00265828 predicted 304
4 SASI_Mm01_00265829 predicted 508
5 SASI_Mm01_00265830 predicted 612
6 SASI_Mm01_00265831 predicted 247
7 SASI_Mm01_00265832 predicted 448
8 SASI_Mm01_00265833 predicted 865
9 SASI_Mm01_00265834 predicted 696
10 SASI_Mm01_00265835 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020117
VALIDATED
LARS MISSION shRNA Bacterial Glycerol Stock
leucyl-tRNA synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1246s21c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1369s21c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-2410s21c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-3290s21c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1203s1c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1080s1c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2649s1c1
Sequence:CCGGCGCTCCATTCTGTCCACATTTCTCGAGAAATGTGGACAGAATGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2244s1c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-3124s1c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020117
VALIDATED
LARS MISSION shRNA shRNA Plasmid DNA
leucyl-tRNA synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1246s21c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1369s21c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-2410s21c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-3290s21c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1203s1c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1080s1c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2649s1c1
Sequence:CCGGCGCTCCATTCTGTCCACATTTCTCGAGAAATGTGGACAGAATGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2244s1c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-3124s1c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020117
VALIDATED
LARS MISSION shRNA Lentiviral Transduction Particles
leucyl-tRNA synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1246s21c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-1369s21c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-2410s21c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020117.9-3290s21c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1203s1c1
Sequence:CCGGGCTAACTATTAAGGAGGATAACTCGAGTTATCCTCCTTAATAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-1080s1c1
Sequence:CCGGCCAGGGCTTTACCAAAGACAACTCGAGTTGTCTTTGGTAAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2649s1c1
Sequence:CCGGCGCTCCATTCTGTCCACATTTCTCGAGAAATGTGGACAGAATGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-2244s1c1
Sequence:CCGGCCTCACTTTGACCCAAGCTATCTCGAGATAGCTTGGGTCAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020117.8-3124s1c1
Sequence:CCGGGCTGTGCTTATGGAGAATATACTCGAGTATATTCTCCATAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134137
VALIDATED
LARS MISSION shRNA Bacterial Glycerol Stock
leucyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-3675s21c1
Sequence:CCGGCGGATACTTCTGCTCCGAGAACTCGAGTTCTCGGAGCAGAAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134137.2-384s21c1
Sequence:CCGGCTGTACTGGTATGCCTATTAACTCGAGTTAATAGGCATACCAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1234s21c1
Sequence:CCGGCTCCCTATGCTGACCATTAAACTCGAGTTTAATGGTCAGCATAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1149s21c1
Sequence:CCGGGCCGGTTGTGAAGGAGTTAATCTCGAGATTAACTCCTTCACAACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134137
VALIDATED
LARS MISSION shRNA shRNA Plasmid DNA
leucyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-3675s21c1
Sequence:CCGGCGGATACTTCTGCTCCGAGAACTCGAGTTCTCGGAGCAGAAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134137.2-384s21c1
Sequence:CCGGCTGTACTGGTATGCCTATTAACTCGAGTTAATAGGCATACCAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1234s21c1
Sequence:CCGGCTCCCTATGCTGACCATTAAACTCGAGTTTAATGGTCAGCATAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1149s21c1
Sequence:CCGGGCCGGTTGTGAAGGAGTTAATCTCGAGATTAACTCCTTCACAACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134137
VALIDATED
LARS MISSION shRNA Lentiviral Transduction Particles
leucyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-3675s21c1
Sequence:CCGGCGGATACTTCTGCTCCGAGAACTCGAGTTCTCGGAGCAGAAGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134137.2-384s21c1
Sequence:CCGGCTGTACTGGTATGCCTATTAACTCGAGTTAATAGGCATACCAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1234s21c1
Sequence:CCGGCTCCCTATGCTGACCATTAAACTCGAGTTTAATGGTCAGCATAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134137.2-1149s21c1
Sequence:CCGGGCCGGTTGTGAAGGAGTTAATCTCGAGATTAACTCCTTCACAACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)