EMAIL THIS PAGE TO A FRIEND

LAS1L

LAS1-like (S. cerevisiae)

74 Gene Product Result for
Synonyms: Las1-like dJ475B7.2
UniProtKB ID: Q9Y4W2, A9X410, Q5JXQ0, Q8TEN5, Q9H9V5
Gene ID:
Mouse(76130) LAS1-like (S. cerevisiae)
Rat(296865) LAS1-like (S. cerevisiae)
Zebrafish(324902) LAS1-like (S. cerevisiae)
domestic cat(101093008) LAS1-like (S. cerevisiae)
dog(480941) LAS1-like (S. cerevisiae)
cow(507924) LAS1-like (S. cerevisiae)
chicken(422174) LAS1-like (S. cerevisiae)
domestic guinea pig(100733285) LAS1-like (S. cerevisiae)
naked mole-rat(101713131) LAS1-like (S. cerevisiae)
sheep(101112288) LAS1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031206 Rosetta Predictions human pricing
XM_001067427 Rosetta Predictions rat pricing
XM_216095 Rosetta Predictions rat pricing
NM_152822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028712 predicted 344
2 SASI_Hs01_00028713 predicted 1507
3 SASI_Hs01_00028715 predicted 578
4 SASI_Hs01_00028716 predicted 844
5 SASI_Hs01_00028717 predicted 397
6 SASI_Hs01_00028718 predicted 352
7 SASI_Hs01_00028720 predicted 812
8 SASI_Hs02_00358610 predicted 740
9 SASI_Hs01_00028721 predicted 388
10 SASI_Hs02_00358611 predicted 507
11 SASI_Hs01_00028714 predicted 1588
12 SASI_Hs01_00028719 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320963 predicted 722
2 SASI_Rn02_00320964 predicted 785
3 SASI_Rn02_00320965 predicted 681
4 SASI_Rn02_00320966 predicted 803
5 SASI_Rn02_00320967 predicted 330
6 SASI_Rn02_00320968 predicted 291
7 SASI_Rn02_00320969 predicted 861
8 SASI_Rn02_00320970 predicted 202
9 SASI_Rn02_00320971 predicted 722
10 SASI_Rn02_00320972 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376430 predicted 547
2 SASI_Rn02_00376431 predicted 670
3 SASI_Rn02_00376432 predicted 735
4 SASI_Rn02_00376433 predicted 633
5 SASI_Rn02_00376434 predicted 755
6 SASI_Rn02_00376435 predicted 283
7 SASI_Rn02_00376436 predicted 237
8 SASI_Rn02_00376437 predicted 815
9 SASI_Rn02_00376438 predicted 677
10 SASI_Rn02_00376439 predicted 2180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060149 predicted 867
2 SASI_Mm01_00060152 predicted 224
3 SASI_Mm01_00060153 predicted 922
4 SASI_Mm01_00060154 predicted 388
5 SASI_Mm01_00060155 predicted 934
6 SASI_Mm01_00060156 predicted 882
7 SASI_Mm01_00060157 predicted 1346
8 SASI_Mm01_00060158 predicted 380
9 SASI_Mm02_00342829 predicted 780
10 SASI_Mm02_00342830 predicted 2340
11 SASI_Mm01_00060150 predicted 427
12 SASI_Mm01_00060151 predicted 1379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031206
VALIDATED
LAS1L MISSION shRNA Bacterial Glycerol Stock
LAS1-like (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1090s21c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-587s21c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-849s21c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1643s21c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-517s1c1
Sequence:CCGGCCGGATTGGATTGTTGACCTTCTCGAGAAGGTCAACAATCCAATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-400s1c1
Sequence:CCGGGATGAACTTAGACTGCTCTATCTCGAGATAGAGCAGTCTAAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-852s1c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1093s1c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1646s1c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-850s1c1
Sequence:CCGGGCCCTGAGTCATAAAGAGCTACTCGAGTAGCTCTTTATGACTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-540s1c1
Sequence:CCGGCCATGAGTTGACCCACAAGAACTCGAGTTCTTGTGGGTCAACTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-590s1c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031206
VALIDATED
LAS1L MISSION shRNA shRNA Plasmid DNA
LAS1-like (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1090s21c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-587s21c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-849s21c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1643s21c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-517s1c1
Sequence:CCGGCCGGATTGGATTGTTGACCTTCTCGAGAAGGTCAACAATCCAATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-400s1c1
Sequence:CCGGGATGAACTTAGACTGCTCTATCTCGAGATAGAGCAGTCTAAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-852s1c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1093s1c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1646s1c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-850s1c1
Sequence:CCGGGCCCTGAGTCATAAAGAGCTACTCGAGTAGCTCTTTATGACTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-540s1c1
Sequence:CCGGCCATGAGTTGACCCACAAGAACTCGAGTTCTTGTGGGTCAACTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-590s1c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031206
VALIDATED
LAS1L MISSION shRNA Lentiviral Transduction Particles
LAS1-like (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1090s21c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-587s21c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-849s21c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031206.3-1643s21c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-517s1c1
Sequence:CCGGCCGGATTGGATTGTTGACCTTCTCGAGAAGGTCAACAATCCAATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-400s1c1
Sequence:CCGGGATGAACTTAGACTGCTCTATCTCGAGATAGAGCAGTCTAAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-852s1c1
Sequence:CCGGCCTGAGTCATAAAGAGCTATACTCGAGTATAGCTCTTTATGACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1093s1c1
Sequence:CCGGGCAGCTTTGCAGATAGAATATCTCGAGATATTCTATCTGCAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-1646s1c1
Sequence:CCGGCCATTGGGAAGTCTCCATATACTCGAGTATATGGAGACTTCCCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-850s1c1
Sequence:CCGGGCCCTGAGTCATAAAGAGCTACTCGAGTAGCTCTTTATGACTCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031206.2-540s1c1
Sequence:CCGGCCATGAGTTGACCCACAAGAACTCGAGTTCTTGTGGGTCAACTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031206.2-590s1c1
Sequence:CCGGGCTGCTACTTTGTCCTGGATTCTCGAGAATCCAGGACAAAGTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152822
VALIDATED
LAS1L MISSION shRNA Bacterial Glycerol Stock
LAS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-266s21c1
Sequence:CCGGAGTATGCGCTGAACCGAATTACTCGAGTAATTCGGTTCAGCGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-928s21c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-2399s21c1
Sequence:CCGGCCTGATGCCAGTGTCCATGTACTCGAGTACATGGACACTGGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.2-928s1c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-1513s21c1
Sequence:CCGGCTGCGAGTCTGTTCCATTTATCTCGAGATAAATGGAACAGACTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-218s21c1
Sequence:CCGGGGGAGCAAGTGACGGTTTATCCTCGAGGATAAACCGTCACTTGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-644s1c1
Sequence:CCGGCGTGAAATTATTGCCGATGATCTCGAGATCATCGGCAATAATTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-809s1c1
Sequence:CCGGCGAGAATTGCTGGTATCCTATCTCGAGATAGGATACCAGCAATTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152822
VALIDATED
LAS1L MISSION shRNA shRNA Plasmid DNA
LAS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-266s21c1
Sequence:CCGGAGTATGCGCTGAACCGAATTACTCGAGTAATTCGGTTCAGCGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-928s21c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-2399s21c1
Sequence:CCGGCCTGATGCCAGTGTCCATGTACTCGAGTACATGGACACTGGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.2-928s1c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-1513s21c1
Sequence:CCGGCTGCGAGTCTGTTCCATTTATCTCGAGATAAATGGAACAGACTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-218s21c1
Sequence:CCGGGGGAGCAAGTGACGGTTTATCCTCGAGGATAAACCGTCACTTGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-644s1c1
Sequence:CCGGCGTGAAATTATTGCCGATGATCTCGAGATCATCGGCAATAATTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-809s1c1
Sequence:CCGGCGAGAATTGCTGGTATCCTATCTCGAGATAGGATACCAGCAATTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152822
VALIDATED
LAS1L MISSION shRNA Lentiviral Transduction Particles
LAS1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-266s21c1
Sequence:CCGGAGTATGCGCTGAACCGAATTACTCGAGTAATTCGGTTCAGCGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-928s21c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-2399s21c1
Sequence:CCGGCCTGATGCCAGTGTCCATGTACTCGAGTACATGGACACTGGCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.2-928s1c1
Sequence:CCGGCATTTGCTTCAGGCTATTAAACTCGAGTTTAATAGCCTGAAGCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-1513s21c1
Sequence:CCGGCTGCGAGTCTGTTCCATTTATCTCGAGATAAATGGAACAGACTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152822.2-218s21c1
Sequence:CCGGGGGAGCAAGTGACGGTTTATCCTCGAGGATAAACCGTCACTTGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-644s1c1
Sequence:CCGGCGTGAAATTATTGCCGATGATCTCGAGATCATCGGCAATAATTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152822.1-809s1c1
Sequence:CCGGCGAGAATTGCTGGTATCCTATCTCGAGATAGGATACCAGCAATTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)