EMAIL THIS PAGE TO A FRIEND

LASP1

LIM and SH3 protein 1

112 Gene Product Result for
Synonyms: Lasp-1 MLN50
UniProtKB ID: Q14847, Q96ED2, Q96IG0
Gene ID:
Human(3927) Summary: This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
Mouse(16796) LIM and SH3 protein 1
Rat(29278) LIM and SH3 protein 1
Zebrafish(323216) LIM and SH3 protein 1
chicken(420002) LIM and SH3 protein 1
cow(532851) LIM and SH3 protein 1
domestic cat(101088284) LIM and SH3 protein 1
dog(608624) LIM and SH3 protein 1
sheep(101121869) LIM and SH3 protein 1
Domestic Rabbit(100009568) LIM and SH3 protein 1
domestic guinea pig(100726273) LIM and SH3 protein 1
naked mole-rat(101717600) LIM and SH3 protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006148 Rosetta Predictions human pricing
NM_032613 Rosetta Predictions rat pricing
NM_010688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139094 predicted 1052
2 SASI_Hs01_00139095 predicted 350
3 SASI_Hs01_00139096 predicted 326
4 SASI_Hs01_00139097 predicted 415
5 SASI_Hs01_00139098 predicted 289
6 SASI_Hs01_00139099 predicted 929
7 SASI_Hs01_00139100 predicted 364
8 SASI_Hs01_00139101 predicted 374
9 SASI_Hs01_00139102 predicted 1267
10 SASI_Hs01_00139103 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040826 predicted 328
2 SASI_Rn01_00040827 predicted 283
3 SASI_Rn01_00040829 predicted 1061
4 SASI_Rn01_00040830 predicted 1199
5 SASI_Rn02_00265480 predicted 967
6 SASI_Rn01_00040831 predicted 776
7 SASI_Rn01_00040832 predicted 842
8 SASI_Rn01_00040833 predicted 335
9 SASI_Rn01_00040834 predicted 213
10 SASI_Rn02_00265481 predicted 1176
11 SASI_Rn01_00040825 predicted 804
12 SASI_Rn01_00040828 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142770 predicted 1223
2 SASI_Mm01_00142771 predicted 366
3 SASI_Mm02_00319129 predicted 411
4 SASI_Mm01_00142772 predicted 890
5 SASI_Mm01_00142774 predicted 1229
6 SASI_Mm02_00319130 predicted 832
7 SASI_Mm01_00142776 predicted 1008
8 SASI_Mm01_00142778 predicted 294
9 SASI_Mm02_00319131 predicted 331
10 SASI_Mm02_00319132 predicted 976
11 SASI_Mm01_00142769 predicted 1178
12 SASI_Mm01_00142773 predicted 263
13 SASI_Mm01_00142775 predicted 262
14 SASI_Mm01_00142777 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010688
VALIDATED
LASP1 MISSION shRNA Bacterial Glycerol Stock
LIM and SH3 protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010688.2-2493s1c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-274s1c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-462s1c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-373s1c1
Sequence:CCGGGTGCGCTACAAGGAGGAATTTCTCGAGAAATTCCTCCTTGTAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010688.2-249s1c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-461s21c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-273s21c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-248s21c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010688.4-2492s21c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010688
VALIDATED
LASP1 MISSION shRNA shRNA Plasmid DNA
LIM and SH3 protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010688.2-2493s1c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-274s1c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-462s1c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-373s1c1
Sequence:CCGGGTGCGCTACAAGGAGGAATTTCTCGAGAAATTCCTCCTTGTAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010688.2-249s1c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-461s21c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-273s21c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-248s21c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010688.4-2492s21c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010688
VALIDATED
LASP1 MISSION shRNA Lentiviral Transduction Particles
LIM and SH3 protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010688.2-2493s1c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-274s1c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-462s1c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010688.2-373s1c1
Sequence:CCGGGTGCGCTACAAGGAGGAATTTCTCGAGAAATTCCTCCTTGTAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010688.2-249s1c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-461s21c1
Sequence:CCGGCCAGGACCAGATCAGCAATATCTCGAGATATTGCTGATCTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-273s21c1
Sequence:CCGGCCTTACTGCAATGCACACTATCTCGAGATAGTGTGCATTGCAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010688.4-248s21c1
Sequence:CCGGGAACTACAAGGGTTATGAGAACTCGAGTTCTCATAACCCTTGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010688.4-2492s21c1
Sequence:CCGGGCCTGGTCAATCCCTTTACTTCTCGAGAAGTAAAGGGATTGACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006148
VALIDATED
LASP1 MISSION shRNA Bacterial Glycerol Stock
LIM and SH3 protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-201s1c1
Sequence:CCGGGAACTACAAGGGCTACGAGAACTCGAGTTCTCGTAGCCCTTGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-136s1c1
Sequence:CCGGCTGGATAAGTTCTGGCATAAACTCGAGTTTATGCCAGAACTTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-414s1c1
Sequence:CCGGCCAGGACCAGATCAGTAATATCTCGAGATATTACTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-134s1c1
Sequence:CCGGGTCTGGATAAGTTCTGGCATACTCGAGTATGCCAGAACTTATCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-2101s1c1
Sequence:CCGGGCAGAGAAGTTCCTTAGGTTTCTCGAGAAACCTAAGGAACTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-645s21c1
Sequence:CCGGCCGAGCTCCAGAGAATCAAGACTCGAGTCTTGATTCTCTGGAGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-614s21c1
Sequence:CCGGGGCAAAGGTTTCAGCGTAGTGCTCGAGCACTACGCTGAAACCTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-873s21c1
Sequence:CCGGAGTCCTATGGTGGCTACAAGGCTCGAGCCTTGTAGCCACCATAGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-368s21c1
Sequence:CCGGTATCCCACGGAGAAGGTGAACCTCGAGGTTCACCTTCTCCGTGGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006148.2-1213s21c1
Sequence:CCGGACCTGCGACAGCTTGTGATTCCTCGAGGAATCACAAGCTGTCGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-483s21c1
Sequence:CCGGCCTACTGCAACGCACACTACCCTCGAGGGTAGTGTGCGTTGCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006148
VALIDATED
LASP1 MISSION shRNA shRNA Plasmid DNA
LIM and SH3 protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-201s1c1
Sequence:CCGGGAACTACAAGGGCTACGAGAACTCGAGTTCTCGTAGCCCTTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-136s1c1
Sequence:CCGGCTGGATAAGTTCTGGCATAAACTCGAGTTTATGCCAGAACTTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-414s1c1
Sequence:CCGGCCAGGACCAGATCAGTAATATCTCGAGATATTACTGATCTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-134s1c1
Sequence:CCGGGTCTGGATAAGTTCTGGCATACTCGAGTATGCCAGAACTTATCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-2101s1c1
Sequence:CCGGGCAGAGAAGTTCCTTAGGTTTCTCGAGAAACCTAAGGAACTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-645s21c1
Sequence:CCGGCCGAGCTCCAGAGAATCAAGACTCGAGTCTTGATTCTCTGGAGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-614s21c1
Sequence:CCGGGGCAAAGGTTTCAGCGTAGTGCTCGAGCACTACGCTGAAACCTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-873s21c1
Sequence:CCGGAGTCCTATGGTGGCTACAAGGCTCGAGCCTTGTAGCCACCATAGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-368s21c1
Sequence:CCGGTATCCCACGGAGAAGGTGAACCTCGAGGTTCACCTTCTCCGTGGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006148.2-1213s21c1
Sequence:CCGGACCTGCGACAGCTTGTGATTCCTCGAGGAATCACAAGCTGTCGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-483s21c1
Sequence:CCGGCCTACTGCAACGCACACTACCCTCGAGGGTAGTGTGCGTTGCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006148
VALIDATED
LASP1 MISSION shRNA Lentiviral Transduction Particles
LIM and SH3 protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-201s1c1
Sequence:CCGGGAACTACAAGGGCTACGAGAACTCGAGTTCTCGTAGCCCTTGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-136s1c1
Sequence:CCGGCTGGATAAGTTCTGGCATAAACTCGAGTTTATGCCAGAACTTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-414s1c1
Sequence:CCGGCCAGGACCAGATCAGTAATATCTCGAGATATTACTGATCTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-134s1c1
Sequence:CCGGGTCTGGATAAGTTCTGGCATACTCGAGTATGCCAGAACTTATCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006148.1-2101s1c1
Sequence:CCGGGCAGAGAAGTTCCTTAGGTTTCTCGAGAAACCTAAGGAACTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-645s21c1
Sequence:CCGGCCGAGCTCCAGAGAATCAAGACTCGAGTCTTGATTCTCTGGAGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-614s21c1
Sequence:CCGGGGCAAAGGTTTCAGCGTAGTGCTCGAGCACTACGCTGAAACCTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-873s21c1
Sequence:CCGGAGTCCTATGGTGGCTACAAGGCTCGAGCCTTGTAGCCACCATAGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-368s21c1
Sequence:CCGGTATCCCACGGAGAAGGTGAACCTCGAGGTTCACCTTCTCCGTGGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006148.2-1213s21c1
Sequence:CCGGACCTGCGACAGCTTGTGATTCCTCGAGGAATCACAAGCTGTCGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006148.2-483s21c1
Sequence:CCGGCCTACTGCAACGCACACTACCCTCGAGGGTAGTGTGCGTTGCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)