EMAIL THIS PAGE TO A FRIEND

LAT2

linker for activation of T cells family, member 2

93 Gene Product Result for
Synonyms: LAB NTAL WBSCR15 WBSCR5 WSCR5
Gene ID:
Human(7462) Summary: This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(56743) linker for activation of T cells family, member 2
Rat(317676) linker for activation of T cells family, member 2
sheep(443250) linker for activation of T cells family, member 2
domestic guinea pig(101789003) linker for activation of T cells family, member 2
naked mole-rat(101725737) linker for activation of T cells family, member 2
chicken(417489) linker for activation of T cells family, member 2
dog(607740) linker for activation of T cells family, member 2
domestic cat(101098351) linker for activation of T cells family, member 2
cow(505016) linker for activation of T cells family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1612 Human NTAL ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073591 MISSION® esiRNA esiRNA human LAT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014146 Rosetta Predictions human pricing
NM_022040 Rosetta Predictions human pricing
NM_032463 Rosetta Predictions human pricing
NM_032464 Rosetta Predictions human pricing
NM_173840 Rosetta Predictions rat pricing
NM_020044 Rosetta Predictions mouse pricing
NM_022964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234358 predicted 1557
2 SASI_Hs01_00234359 predicted 630
3 SASI_Hs02_00345142 predicted 1560
4 SASI_Hs01_00234360 predicted 1517
5 SASI_Hs01_00234361 predicted 1511
6 SASI_Hs01_00234362 predicted 584
7 SASI_Hs01_00234363 predicted 637
8 SASI_Hs01_00234364 predicted 1369
9 SASI_Hs01_00234366 predicted 1460
10 SASI_Hs01_00234367 predicted 1206
11 SASI_Hs01_00234365 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040847 predicted 1750
2 SASI_Hs01_00040848 predicted 818
3 SASI_Hs01_00040849 predicted 1716
4 SASI_Hs01_00040850 predicted 1706
5 SASI_Hs01_00040851 predicted 781
6 SASI_Hs01_00040852 predicted 836
7 SASI_Hs01_00040853 predicted 1562
8 SASI_Hs01_00040854 predicted 1106
9 SASI_Hs01_00040855 predicted 1651
10 SASI_Hs01_00040856 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085906 predicted 1676
2 SASI_Hs01_00085907 predicted 741
3 SASI_Hs02_00359901 predicted 1680
4 SASI_Hs01_00085908 predicted 1635
5 SASI_Hs01_00085909 predicted 1629
6 SASI_Hs01_00085910 predicted 710
7 SASI_Hs01_00085911 predicted 756
8 SASI_Hs01_00085912 predicted 1496
9 SASI_Hs01_00085914 predicted 1576
10 SASI_Hs01_00085915 predicted 1316
11 SASI_Hs01_00085913 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359902 predicted 1741
2 SASI_Hs02_00359903 predicted 812
3 SASI_Hs02_00359904 predicted 1753
4 SASI_Hs02_00359905 predicted 1706
5 SASI_Hs02_00359906 predicted 1706
6 SASI_Hs02_00359907 predicted 776
7 SASI_Hs02_00359908 predicted 829
8 SASI_Hs02_00359909 predicted 1565
9 SASI_Hs02_00359910 predicted 1649
10 SASI_Hs02_00359911 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072137 predicted 210
2 SASI_Rn01_00072138 predicted 321
3 SASI_Rn01_00072139 predicted 218
4 SASI_Rn01_00072140 predicted 306
5 SASI_Rn01_00072141 predicted 212
6 SASI_Rn01_00072142 predicted 216
7 SASI_Rn01_00072143 predicted 211
8 SASI_Rn01_00072144 predicted 394
9 SASI_Rn01_00072145 predicted 221
10 SASI_Rn01_00072146 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059523 predicted 943
2 SASI_Mm01_00059524 predicted 869
3 SASI_Mm01_00059525 predicted 700
4 SASI_Mm01_00059526 predicted 775
5 SASI_Mm01_00059527 predicted 811
6 SASI_Mm01_00059529 predicted 744
7 SASI_Mm01_00059530 predicted 709
8 SASI_Mm01_00059531 predicted 684
9 SASI_Mm01_00059532 predicted 756
10 SASI_Mm02_00325410 predicted 775
11 SASI_Mm01_00059528 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068279 predicted 911
2 SASI_Mm01_00068280 predicted 827
3 SASI_Mm01_00068281 predicted 657
4 SASI_Mm01_00068282 predicted 735
5 SASI_Mm01_00068283 predicted 781
6 SASI_Mm01_00068285 predicted 708
7 SASI_Mm01_00068286 predicted 674
8 SASI_Mm01_00068287 predicted 653
9 SASI_Mm01_00068288 predicted 716
10 SASI_Mm02_00326695 predicted 739
11 SASI_Mm01_00068284 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014146
LAT2 MISSION shRNA Bacterial Glycerol Stock
linker for activation of T cells family, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014146.3-1522s21c1
Sequence:CCGGAGCTTGTACAGTTAACTTATACTCGAGTATAAGTTAACTGTACAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-729s1c1
Sequence:CCGGGAAGATGAGGAATCTGAGGATCTCGAGATCCTCAGATTCCTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014146.3-1047s21c1
Sequence:CCGGGGGAACCGGATTACGTGAATGCTCGAGCATTCACGTAATCCGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-755s1c1
Sequence:CCGGGAACTCAGCATCCATCCATCACTCGAGTGATGGATGGATGCTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014146.2-1596s1c1
Sequence:CCGGCTAGAGAAGTAGTGACCAGAACTCGAGTTCTGGTCACTACTTCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-732s1c1
Sequence:CCGGGATGAGGAATCTGAGGATTATCTCGAGATAATCCTCAGATTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-744s1c1
Sequence:CCGGGAGGATTATCAGAACTCAGCACTCGAGTGCTGAGTTCTGATAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014146
LAT2 MISSION shRNA shRNA Plasmid DNA
linker for activation of T cells family, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014146.3-1522s21c1
Sequence:CCGGAGCTTGTACAGTTAACTTATACTCGAGTATAAGTTAACTGTACAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-729s1c1
Sequence:CCGGGAAGATGAGGAATCTGAGGATCTCGAGATCCTCAGATTCCTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014146.3-1047s21c1
Sequence:CCGGGGGAACCGGATTACGTGAATGCTCGAGCATTCACGTAATCCGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-755s1c1
Sequence:CCGGGAACTCAGCATCCATCCATCACTCGAGTGATGGATGGATGCTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014146.2-1596s1c1
Sequence:CCGGCTAGAGAAGTAGTGACCAGAACTCGAGTTCTGGTCACTACTTCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-732s1c1
Sequence:CCGGGATGAGGAATCTGAGGATTATCTCGAGATAATCCTCAGATTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-744s1c1
Sequence:CCGGGAGGATTATCAGAACTCAGCACTCGAGTGCTGAGTTCTGATAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014146
LAT2 MISSION shRNA Lentiviral Transduction Particles
linker for activation of T cells family, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014146.3-1522s21c1
Sequence:CCGGAGCTTGTACAGTTAACTTATACTCGAGTATAAGTTAACTGTACAAGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-729s1c1
Sequence:CCGGGAAGATGAGGAATCTGAGGATCTCGAGATCCTCAGATTCCTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014146.3-1047s21c1
Sequence:CCGGGGGAACCGGATTACGTGAATGCTCGAGCATTCACGTAATCCGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-755s1c1
Sequence:CCGGGAACTCAGCATCCATCCATCACTCGAGTGATGGATGGATGCTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014146.2-1596s1c1
Sequence:CCGGCTAGAGAAGTAGTGACCAGAACTCGAGTTCTGGTCACTACTTCTCTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-732s1c1
Sequence:CCGGGATGAGGAATCTGAGGATTATCTCGAGATAATCCTCAGATTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014146.2-744s1c1
Sequence:CCGGGAGGATTATCAGAACTCAGCACTCGAGTGCTGAGTTCTGATAATCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022964
LAT2 MISSION shRNA Bacterial Glycerol Stock
linker for activation of T cells family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022964.3-810s1c1
Sequence:CCGGGCCTGCTGAATAAAGCCTGTTCTCGAGAACAGGCTTTATTCAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-473s1c1
Sequence:CCGGCATCCCTACAAACTACTACAACTCGAGTTGTAGTAGTTTGTAGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-381s1c1
Sequence:CCGGGCTCCAAACAAGTCATTTGAACTCGAGTTCAAATGACTTGTTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-527s1c1
Sequence:CCGGCGATTCCAACTCCTACGAGAACTCGAGTTCTCGTAGGAGTTGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-687s1c1
Sequence:CCGGGAGGAGCCAGACTATGTGAATCTCGAGATTCACATAGTCTGGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022964
LAT2 MISSION shRNA shRNA Plasmid DNA
linker for activation of T cells family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022964.3-810s1c1
Sequence:CCGGGCCTGCTGAATAAAGCCTGTTCTCGAGAACAGGCTTTATTCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-473s1c1
Sequence:CCGGCATCCCTACAAACTACTACAACTCGAGTTGTAGTAGTTTGTAGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-381s1c1
Sequence:CCGGGCTCCAAACAAGTCATTTGAACTCGAGTTCAAATGACTTGTTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-527s1c1
Sequence:CCGGCGATTCCAACTCCTACGAGAACTCGAGTTCTCGTAGGAGTTGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-687s1c1
Sequence:CCGGGAGGAGCCAGACTATGTGAATCTCGAGATTCACATAGTCTGGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022964
LAT2 MISSION shRNA Lentiviral Transduction Particles
linker for activation of T cells family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022964.3-810s1c1
Sequence:CCGGGCCTGCTGAATAAAGCCTGTTCTCGAGAACAGGCTTTATTCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-473s1c1
Sequence:CCGGCATCCCTACAAACTACTACAACTCGAGTTGTAGTAGTTTGTAGGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-381s1c1
Sequence:CCGGGCTCCAAACAAGTCATTTGAACTCGAGTTCAAATGACTTGTTTGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-527s1c1
Sequence:CCGGCGATTCCAACTCCTACGAGAACTCGAGTTCTCGTAGGAGTTGGAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022964.3-687s1c1
Sequence:CCGGGAGGAGCCAGACTATGTGAATCTCGAGATTCACATAGTCTGGCTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)