EMAIL THIS PAGE TO A FRIEND

LAT

linker for activation of T cells

91 Gene Product Result for
Synonyms: LAT1 pp36
UniProtKB ID: O43561, O43919
Gene ID:
Human(27040) Summary: The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(16797) linker for activation of T cells
Rat(81511) linker for activation of T cells
Zebrafish(100233211) linker for activation of T cells
cow(514735) linker for activation of T cells
domestic cat(101093319) linker for activation of T cells
dog(607947) linker for activation of T cells
sheep(101110725) linker for activation of T cells
domestic guinea pig(100723774) linker for activation of T cells
naked mole-rat(101711455) linker for activation of T cells
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014987 Rosetta Predictions human pricing
NM_001014988 Rosetta Predictions human pricing
NM_001014989 Rosetta Predictions human pricing
NM_014387 Rosetta Predictions human pricing
NM_030853 Rosetta Predictions rat pricing
NM_010689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150755 predicted 894
2 SASI_Hs01_00150756 predicted 1055
3 SASI_Hs02_00306616 predicted 912
4 SASI_Hs01_00150757 predicted 1083
5 SASI_Hs01_00150758 predicted 914
6 SASI_Hs01_00150759 predicted 901
7 SASI_Hs01_00150760 predicted 969
8 SASI_Hs01_00150761 predicted 914
9 SASI_Hs01_00150762 predicted 1022
10 SASI_Hs01_00150763 predicted 942
11 SASI_Hs01_00150764 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227139 predicted 890
2 SASI_Hs01_00227140 predicted 1053
3 SASI_Hs02_00306617 predicted 905
4 SASI_Hs01_00227141 predicted 1080
5 SASI_Hs01_00227142 predicted 911
6 SASI_Hs01_00227143 predicted 900
7 SASI_Hs01_00227144 predicted 968
8 SASI_Hs01_00227145 predicted 909
9 SASI_Hs01_00227146 predicted 1014
10 SASI_Hs01_00227147 predicted 946
11 SASI_Hs01_00227148 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194653 predicted 686
2 SASI_Hs01_00194654 predicted 844
3 SASI_Hs02_00306618 predicted 700
4 SASI_Hs01_00194655 predicted 878
5 SASI_Hs01_00194656 predicted 704
6 SASI_Hs01_00194657 predicted 693
7 SASI_Hs01_00194658 predicted 757
8 SASI_Hs01_00194659 predicted 712
9 SASI_Hs01_00194660 predicted 811
10 SASI_Hs01_00194661 predicted 734
11 SASI_Hs01_00194662 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031808 predicted 981
2 SASI_Hs01_00031809 predicted 1136
3 SASI_Hs02_00345557 predicted 992
4 SASI_Hs01_00031810 predicted 1175
5 SASI_Hs01_00031811 predicted 1000
6 SASI_Hs01_00031812 predicted 993
7 SASI_Hs01_00031813 predicted 1058
8 SASI_Hs01_00031814 predicted 1003
9 SASI_Hs01_00031815 predicted 1103
10 SASI_Hs01_00031816 predicted 1032
11 SASI_Hs01_00031817 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119206 predicted 521
2 SASI_Rn01_00119207 predicted 713
3 SASI_Rn01_00119208 predicted 795
4 SASI_Rn01_00119209 predicted 344
5 SASI_Rn02_00264097 predicted 589
6 SASI_Rn01_00119210 predicted 606
7 SASI_Rn01_00119211 predicted 705
8 SASI_Rn01_00119212 predicted 585
9 SASI_Rn01_00119213 predicted 375
10 SASI_Rn01_00119215 predicted 524
11 SASI_Rn01_00119214 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087850 predicted 980
2 SASI_Mm01_00087851 predicted 851
3 SASI_Mm01_00087852 predicted 379
4 SASI_Mm01_00087853 predicted 439
5 SASI_Mm01_00087854 predicted 435
6 SASI_Mm01_00087855 predicted 406
7 SASI_Mm01_00087856 predicted 581
8 SASI_Mm01_00087857 predicted 801
9 SASI_Mm01_00087858 predicted 789
10 SASI_Mm01_00087859 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014387
LAT MISSION shRNA Bacterial Glycerol Stock
linker for activation of T cells
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014387.3-1104s21c1
Sequence:CCGGGGGCTCCAGATTACGAGAATCCTCGAGGATTCTCGTAATCTGGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1371s21c1
Sequence:CCGGCCTACTCTGTGTAATAGAATACTCGAGTATTCTATTACACAGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1438s21c1
Sequence:CCGGGTGCGAGTCTGAGTCAGAGATCTCGAGATCTCTGACTCAGACTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-197s1c1
Sequence:CCGGCCTCAGATAGTTTGTATCCAACTCGAGTTGGATACAAACTATCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-663s1c1
Sequence:CCGGGTCCATTGATGATTACGTGAACTCGAGTTCACGTAATCATCAATGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-540s1c1
Sequence:CCGGCGACTATCACAACCCAGGCTACTCGAGTAGCCTGGGTTGTGATAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-738s1c1
Sequence:CCGGTGTGAATGTGTCCCAGGAACTCTCGAGAGTTCCTGGGACACATTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-132s1c1
Sequence:CCGGCCTGGCCATGTTGATGGCACTCTCGAGAGTGCCATCAACATGGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014387
LAT MISSION shRNA shRNA Plasmid DNA
linker for activation of T cells
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014387.3-1104s21c1
Sequence:CCGGGGGCTCCAGATTACGAGAATCCTCGAGGATTCTCGTAATCTGGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1371s21c1
Sequence:CCGGCCTACTCTGTGTAATAGAATACTCGAGTATTCTATTACACAGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1438s21c1
Sequence:CCGGGTGCGAGTCTGAGTCAGAGATCTCGAGATCTCTGACTCAGACTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-197s1c1
Sequence:CCGGCCTCAGATAGTTTGTATCCAACTCGAGTTGGATACAAACTATCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-663s1c1
Sequence:CCGGGTCCATTGATGATTACGTGAACTCGAGTTCACGTAATCATCAATGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-540s1c1
Sequence:CCGGCGACTATCACAACCCAGGCTACTCGAGTAGCCTGGGTTGTGATAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-738s1c1
Sequence:CCGGTGTGAATGTGTCCCAGGAACTCTCGAGAGTTCCTGGGACACATTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-132s1c1
Sequence:CCGGCCTGGCCATGTTGATGGCACTCTCGAGAGTGCCATCAACATGGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014387
LAT MISSION shRNA Lentiviral Transduction Particles
linker for activation of T cells
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014387.3-1104s21c1
Sequence:CCGGGGGCTCCAGATTACGAGAATCCTCGAGGATTCTCGTAATCTGGAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1371s21c1
Sequence:CCGGCCTACTCTGTGTAATAGAATACTCGAGTATTCTATTACACAGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014387.3-1438s21c1
Sequence:CCGGGTGCGAGTCTGAGTCAGAGATCTCGAGATCTCTGACTCAGACTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-197s1c1
Sequence:CCGGCCTCAGATAGTTTGTATCCAACTCGAGTTGGATACAAACTATCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-663s1c1
Sequence:CCGGGTCCATTGATGATTACGTGAACTCGAGTTCACGTAATCATCAATGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-540s1c1
Sequence:CCGGCGACTATCACAACCCAGGCTACTCGAGTAGCCTGGGTTGTGATAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-738s1c1
Sequence:CCGGTGTGAATGTGTCCCAGGAACTCTCGAGAGTTCCTGGGACACATTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014387.2-132s1c1
Sequence:CCGGCCTGGCCATGTTGATGGCACTCTCGAGAGTGCCATCAACATGGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010689
LAT MISSION shRNA Bacterial Glycerol Stock
linker for activation of T cells
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-429s1c1
Sequence:CCGGCCCAAGAAGCATCCTCATCAACTCGAGTTGATGAGGATGCTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-426s1c1
Sequence:CCGGGTACCCAAGAAGCATCCTCATCTCGAGATGAGGATGCTTCTTGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-985s1c1
Sequence:CCGGGCTCCCGACTATGAGAATCTACTCGAGTAGATTCTCATAGTCGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010689.2-1068s1c1
Sequence:CCGGGCTAAGAGGATCCCATTTGATCTCGAGATCAAATGGGATCCTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-643s1c1
Sequence:CCGGCCAGCCTGTAAGAATGTGGATCTCGAGATCCACATTCTTACAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010689
LAT MISSION shRNA shRNA Plasmid DNA
linker for activation of T cells
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-429s1c1
Sequence:CCGGCCCAAGAAGCATCCTCATCAACTCGAGTTGATGAGGATGCTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-426s1c1
Sequence:CCGGGTACCCAAGAAGCATCCTCATCTCGAGATGAGGATGCTTCTTGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-985s1c1
Sequence:CCGGGCTCCCGACTATGAGAATCTACTCGAGTAGATTCTCATAGTCGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010689.2-1068s1c1
Sequence:CCGGGCTAAGAGGATCCCATTTGATCTCGAGATCAAATGGGATCCTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-643s1c1
Sequence:CCGGCCAGCCTGTAAGAATGTGGATCTCGAGATCCACATTCTTACAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010689
LAT MISSION shRNA Lentiviral Transduction Particles
linker for activation of T cells
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-429s1c1
Sequence:CCGGCCCAAGAAGCATCCTCATCAACTCGAGTTGATGAGGATGCTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-426s1c1
Sequence:CCGGGTACCCAAGAAGCATCCTCATCTCGAGATGAGGATGCTTCTTGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-985s1c1
Sequence:CCGGGCTCCCGACTATGAGAATCTACTCGAGTAGATTCTCATAGTCGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010689.2-1068s1c1
Sequence:CCGGGCTAAGAGGATCCCATTTGATCTCGAGATCAAATGGGATCCTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010689.2-643s1c1
Sequence:CCGGCCAGCCTGTAAGAATGTGGATCTCGAGATCCACATTCTTACAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)