EMAIL THIS PAGE TO A FRIEND

LATS1

large tumor suppressor kinase 1

185 Gene Product Result for
Synonyms: WARTS wts
UniProtKB ID: O95835, Q6PKD0
Gene ID:
Human(9113) Summary: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(16798) large tumor suppressor
Rat(308265) large tumor suppressor kinase 1
sheep(101122867) LATS, large tumor suppressor, homolog 1 (Drosophila)
Domestic Rabbit(100341222) LATS, large tumor suppressor, homolog 1 (Drosophila)
domestic guinea pig(100716806) large tumor suppressor kinase 1
naked mole-rat(101725200) large tumor suppressor kinase 1
Zebrafish(553164) LATS, large tumor suppressor, homolog 1 (Drosophila)
chicken(421627) LATS, large tumor suppressor, homolog 1 (Drosophila)
cow(535935) LATS, large tumor suppressor, homolog 1 (Drosophila)
Horse(100060397) LATS, large tumor suppressor, homolog 1 (Drosophila)
domestic cat(101081470) LATS, large tumor suppressor, homolog 1 (Drosophila)
dog(476241) LATS, large tumor suppressor, homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_194716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004690 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073831 MISSION® esiRNA esiRNA targeting mouse Lats1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004690 siRNAs that have been validated in the lab human pricing
NM_001134543 Rosetta Predictions rat pricing
XR_008525 Rosetta Predictions rat pricing
NM_010690 Rosetta Predictions mouse pricing
XM_618738 Rosetta Predictions mouse pricing
XM_896121 Rosetta Predictions mouse pricing
XM_896130 Rosetta Predictions mouse pricing
XM_896148 Rosetta Predictions mouse pricing
XM_896154 Rosetta Predictions mouse pricing
XM_974422 Rosetta Predictions mouse pricing
XM_974462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004690 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046128 validated 946
1 SASI_Hs01_00046130 validated 2377
2 SASI_Hs01_00046129 predicted 679
3 SASI_Hs02_00338127 predicted 1530
4 SASI_Hs01_00046131 predicted 2755
5 SASI_Hs02_00338128 predicted 1012
6 SASI_Hs01_00046132 predicted 1046
7 SASI_Hs01_00046133 predicted 2821
8 SASI_Hs01_00046134 predicted 2952
9 SASI_Hs01_00046135 predicted 2669
10 SASI_Hs01_00046136 predicted 2259
11 SASI_Hs01_00046137 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256919 predicted 2500
2 SASI_Rn02_00256920 predicted 2301
3 SASI_Rn02_00256921 predicted 3177
4 SASI_Rn02_00256922 predicted 2588
5 SASI_Rn02_00256923 predicted 3209
6 SASI_Rn02_00256924 predicted 3288
7 SASI_Rn02_00256925 predicted 2232
8 SASI_Rn02_00256926 predicted 2231
9 SASI_Rn02_00256927 predicted 3038
10 SASI_Rn02_00256928 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191993 predicted 613
2 SASI_Rn01_00191994 predicted 869
3 SASI_Rn01_00191995 predicted 1851
4 SASI_Rn01_00191996 predicted 4139
5 SASI_Rn01_00191997 predicted 2779
6 SASI_Rn01_00191998 predicted 3402
7 SASI_Rn01_00191999 predicted 3494
8 SASI_Rn01_00192000 predicted 3993
9 SASI_Rn01_00192001 predicted 2439
10 SASI_Rn01_00192002 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319133 predicted 876
2 SASI_Mm02_00319134 predicted 570
3 SASI_Mm02_00319135 predicted 1412
4 SASI_Mm02_00319136 predicted 2780
5 SASI_Mm02_00319137 predicted 1840
6 SASI_Mm02_00319138 predicted 2437
7 SASI_Mm02_00319139 predicted 513
8 SASI_Mm02_00319140 predicted 2555
9 SASI_Mm02_00319141 predicted 1326
10 SASI_Mm02_00319142 predicted 3400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281198 predicted 875
2 SASI_Mm01_00281199 predicted 577
3 SASI_Mm01_00281200 predicted 1421
4 SASI_Mm01_00281201 predicted 2783
5 SASI_Mm01_00281202 predicted 1850
6 SASI_Mm01_00281203 predicted 2442
7 SASI_Mm01_00281204 predicted 518
8 SASI_Mm01_00281205 predicted 2568
9 SASI_Mm01_00281206 predicted 1332
10 SASI_Mm01_00281207 predicted 3403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267670 predicted 876
2 SASI_Mm01_00267671 predicted 576
3 SASI_Mm01_00267672 predicted 1413
4 SASI_Mm01_00267673 predicted 2396
5 SASI_Mm01_00267674 predicted 2781
6 SASI_Mm01_00267675 predicted 1853
7 SASI_Mm01_00267676 predicted 2433
8 SASI_Mm01_00267677 predicted 512
9 SASI_Mm01_00267678 predicted 2570
10 SASI_Mm01_00267679 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234619 predicted 876
2 SASI_Mm01_00234620 predicted 576
3 SASI_Mm01_00234621 predicted 1416
4 SASI_Mm01_00234622 predicted 2288
5 SASI_Mm01_00234623 predicted 1107
6 SASI_Mm01_00234624 predicted 1852
7 SASI_Mm01_00234625 predicted 1289
8 SASI_Mm01_00234626 predicted 1834
9 SASI_Mm01_00234627 predicted 2071
10 SASI_Mm01_00234628 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206932 predicted 873
2 SASI_Mm01_00206933 predicted 577
3 SASI_Mm01_00206934 predicted 1422
4 SASI_Mm01_00206935 predicted 2788
5 SASI_Mm01_00206936 predicted 1850
6 SASI_Mm01_00206937 predicted 2437
7 SASI_Mm01_00206938 predicted 509
8 SASI_Mm01_00206939 predicted 2569
9 SASI_Mm01_00206940 predicted 1327
10 SASI_Mm01_00206941 predicted 3376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258689 predicted 874
2 SASI_Mm01_00258690 predicted 577
3 SASI_Mm01_00258691 predicted 1413
4 SASI_Mm01_00258692 predicted 2787
5 SASI_Mm01_00258693 predicted 1847
6 SASI_Mm01_00258694 predicted 2440
7 SASI_Mm01_00258695 predicted 511
8 SASI_Mm01_00258696 predicted 2567
9 SASI_Mm01_00258697 predicted 1330
10 SASI_Mm01_00258698 predicted 3379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226692 predicted 877
2 SASI_Mm01_00226693 predicted 582
3 SASI_Mm01_00226694 predicted 1415
4 SASI_Mm01_00226695 predicted 2789
5 SASI_Mm01_00226696 predicted 1845
6 SASI_Mm01_00226697 predicted 2443
7 SASI_Mm01_00226698 predicted 518
8 SASI_Mm01_00226699 predicted 2569
9 SASI_Mm01_00226700 predicted 1333
10 SASI_Mm01_00226701 predicted 3369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225957 predicted 875
2 SASI_Mm01_00225958 predicted 577
3 SASI_Mm01_00225959 predicted 1415
4 SASI_Mm01_00225960 predicted 2789
5 SASI_Mm01_00225961 predicted 1850
6 SASI_Mm01_00225962 predicted 2436
7 SASI_Mm01_00225963 predicted 510
8 SASI_Mm01_00225964 predicted 2561
9 SASI_Mm01_00225965 predicted 3369
10 SASI_Mm01_00225966 predicted 1214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010690
VALIDATED
LATS1 MISSION shRNA Bacterial Glycerol Stock
large tumor suppressor kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-3991s21c1
Sequence:CCGGTAGTCAATTCTTGGTACTTAACTCGAGTTAAGTACCAAGAATTGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010690.1-2734s21c1
Sequence:CCGGGGGATATGATGAGCCTATTAACTCGAGTTAATAGGCTCATCATATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-1848s21c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-878s21c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-2879s21c1
Sequence:CCGGTGACCGTGATGGCCATATTAACTCGAGTTAATATGGCCATCACGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010690
VALIDATED
LATS1 MISSION shRNA shRNA Plasmid DNA
large tumor suppressor kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-3991s21c1
Sequence:CCGGTAGTCAATTCTTGGTACTTAACTCGAGTTAAGTACCAAGAATTGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010690.1-2734s21c1
Sequence:CCGGGGGATATGATGAGCCTATTAACTCGAGTTAATAGGCTCATCATATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-1848s21c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-878s21c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-2879s21c1
Sequence:CCGGTGACCGTGATGGCCATATTAACTCGAGTTAATATGGCCATCACGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010690
VALIDATED
LATS1 MISSION shRNA Lentiviral Transduction Particles
large tumor suppressor kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-3991s21c1
Sequence:CCGGTAGTCAATTCTTGGTACTTAACTCGAGTTAAGTACCAAGAATTGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010690.1-2734s21c1
Sequence:CCGGGGGATATGATGAGCCTATTAACTCGAGTTAATAGGCTCATCATATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-1848s21c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-878s21c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010690.1-2879s21c1
Sequence:CCGGTGACCGTGATGGCCATATTAACTCGAGTTAATATGGCCATCACGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194716
VALIDATED
LATS1 MISSION shRNA Bacterial Glycerol Stock
large tumor suppressor kinase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-202s1c1
Sequence:CCGGCCACCCAAATTTGGCACACATCTCGAGATGTGTGCCAAATTTGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-1230s1c1
Sequence:CCGGGCCCAACAGGAACAGTCATAACTCGAGTTATGACTGTTCCTGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-504s1c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194716.2-1474s1c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194716
VALIDATED
LATS1 MISSION shRNA shRNA Plasmid DNA
large tumor suppressor kinase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-202s1c1
Sequence:CCGGCCACCCAAATTTGGCACACATCTCGAGATGTGTGCCAAATTTGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-1230s1c1
Sequence:CCGGGCCCAACAGGAACAGTCATAACTCGAGTTATGACTGTTCCTGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-504s1c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194716.2-1474s1c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194716
VALIDATED
LATS1 MISSION shRNA Lentiviral Transduction Particles
large tumor suppressor kinase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-202s1c1
Sequence:CCGGCCACCCAAATTTGGCACACATCTCGAGATGTGTGCCAAATTTGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-1230s1c1
Sequence:CCGGGCCCAACAGGAACAGTCATAACTCGAGTTATGACTGTTCCTGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194716.2-504s1c1
Sequence:CCGGGCAACATTCAATTAACCGAAACTCGAGTTTCGGTTAATTGAATGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194716.2-1474s1c1
Sequence:CCGGCCTATTCAACAGCCCGTGAAACTCGAGTTTCACGGGCTGTTGAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004690
VALIDATED
LATS1 MISSION shRNA Bacterial Glycerol Stock
large tumor suppressor kinase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-2666s1c1
Sequence:CCGGGAAGATAAAGACACTAGGAATCTCGAGATTCCTAGTGTCTTTATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-3151s1c1
Sequence:CCGGCACGGCAAGATAGCATGGATTCTCGAGAATCCATGCTATCTTGCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-4412s1c1
Sequence:CCGGGAGAAATTAAGCCATCGTGTTCTCGAGAACACGATGGCTTAATTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-738s1c1
Sequence:CCGGCAAGTCAGAAATCCACCCAAACTCGAGTTTGGGTGGATTTCTGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2423s1c1
Sequence:CCGGGCGAAGGGAATCTCGTATTCACTCGAGTGAATACGAGATTCCCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-3115s1c1
Sequence:CCGGCACACGATTCTAAGTACTATCCTCGAGGATAGTACTTAGAATCGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2375s1c1
Sequence:CCGGGATTACAACTTCACCTATTACCTCGAGGTAATAGGTGAAGTTGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2835s1c1
Sequence:CCGGGAATGGGTAGTTCGTCTATATCTCGAGATATAGACGAACTACCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004690
VALIDATED
LATS1 MISSION shRNA shRNA Plasmid DNA
large tumor suppressor kinase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-2666s1c1
Sequence:CCGGGAAGATAAAGACACTAGGAATCTCGAGATTCCTAGTGTCTTTATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-3151s1c1
Sequence:CCGGCACGGCAAGATAGCATGGATTCTCGAGAATCCATGCTATCTTGCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-4412s1c1
Sequence:CCGGGAGAAATTAAGCCATCGTGTTCTCGAGAACACGATGGCTTAATTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-738s1c1
Sequence:CCGGCAAGTCAGAAATCCACCCAAACTCGAGTTTGGGTGGATTTCTGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2423s1c1
Sequence:CCGGGCGAAGGGAATCTCGTATTCACTCGAGTGAATACGAGATTCCCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-3115s1c1
Sequence:CCGGCACACGATTCTAAGTACTATCCTCGAGGATAGTACTTAGAATCGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2375s1c1
Sequence:CCGGGATTACAACTTCACCTATTACCTCGAGGTAATAGGTGAAGTTGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2835s1c1
Sequence:CCGGGAATGGGTAGTTCGTCTATATCTCGAGATATAGACGAACTACCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004690
VALIDATED
LATS1 MISSION shRNA Lentiviral Transduction Particles
large tumor suppressor kinase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-2666s1c1
Sequence:CCGGGAAGATAAAGACACTAGGAATCTCGAGATTCCTAGTGTCTTTATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-3151s1c1
Sequence:CCGGCACGGCAAGATAGCATGGATTCTCGAGAATCCATGCTATCTTGCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-4412s1c1
Sequence:CCGGGAGAAATTAAGCCATCGTGTTCTCGAGAACACGATGGCTTAATTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004690.x-738s1c1
Sequence:CCGGCAAGTCAGAAATCCACCCAAACTCGAGTTTGGGTGGATTTCTGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2423s1c1
Sequence:CCGGGCGAAGGGAATCTCGTATTCACTCGAGTGAATACGAGATTCCCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-3115s1c1
Sequence:CCGGCACACGATTCTAAGTACTATCCTCGAGGATAGTACTTAGAATCGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2375s1c1
Sequence:CCGGGATTACAACTTCACCTATTACCTCGAGGTAATAGGTGAAGTTGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004690.2-2835s1c1
Sequence:CCGGGAATGGGTAGTTCGTCTATATCTCGAGATATAGACGAACTACCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)