EMAIL THIS PAGE TO A FRIEND

LATS2

large tumor suppressor kinase 2

109 Gene Product Result for
Synonyms: KPM
UniProtKB ID: Q9NRM7, B1AM47, Q9P2X1
Gene ID:
Human(26524) Summary: This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
Mouse(50523) large tumor suppressor 2
Rat(305922) large tumor suppressor 2
Zebrafish(567674) LATS, large tumor suppressor, homolog 2 (Drosophila)
cow(508208) large tumor suppressor kinase 2
Horse(100050150) LATS, large tumor suppressor, homolog 2 (Drosophila)
domestic cat(101093824) LATS, large tumor suppressor, homolog 2 (Drosophila)
dog(477343) LATS, large tumor suppressor, homolog 2 (Drosophila)
chicken(418949) LATS, large tumor suppressor, homolog 2 (Drosophila)
domestic guinea pig(100725954) large tumor suppressor kinase 2
naked mole-rat(101705060) large tumor suppressor kinase 2
sheep(101117941) LATS, large tumor suppressor, homolog 2 (Drosophila)
Domestic Rabbit(100356876) LATS, large tumor suppressor, homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014572 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055781 MISSION® esiRNA esiRNA human LATS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014572 Rosetta Predictions human pricing
NM_001107267 Rosetta Predictions rat pricing
NM_015771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158803 predicted 875
2 SASI_Hs01_00158804 predicted 3136
3 SASI_Hs01_00158806 predicted 2611
4 SASI_Hs01_00158807 predicted 2392
5 SASI_Hs01_00158808 predicted 2650
6 SASI_Hs02_00345838 predicted 2738
7 SASI_Hs01_00158810 predicted 2380
8 SASI_Hs01_00158811 predicted 3522
9 SASI_Hs01_00158812 predicted 2910
10 SASI_Hs02_00345839 predicted 2394
11 SASI_Hs01_00158805 predicted 2496
12 SASI_Hs01_00158809 predicted 2702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227155 predicted 394
2 SASI_Rn02_00227156 predicted 2469
3 SASI_Rn02_00227157 predicted 3139
4 SASI_Rn02_00227158 predicted 228
5 SASI_Rn02_00227159 predicted 363
6 SASI_Rn02_00227160 predicted 1768
7 SASI_Rn02_00227161 predicted 2024
8 SASI_Rn02_00227162 predicted 2428
9 SASI_Rn02_00227163 predicted 3348
10 SASI_Rn02_00227164 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090459 predicted 872
2 SASI_Mm01_00090460 predicted 2393
3 SASI_Mm01_00090461 predicted 2743
4 SASI_Mm02_00323112 predicted 666
5 SASI_Mm01_00090462 predicted 2608
6 SASI_Mm01_00090463 predicted 635
7 SASI_Mm01_00090465 predicted 2424
8 SASI_Mm01_00090466 predicted 2103
9 SASI_Mm01_00090467 predicted 2688
10 SASI_Mm01_00090468 predicted 2296
11 SASI_Mm01_00090464 predicted 2110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015771
VALIDATED
LATS2 MISSION shRNA Bacterial Glycerol Stock
large tumor suppressor kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2614s21c1
Sequence:CCGGCCGCTTCTACATTGCAGAGTTCTCGAGAACTCTGCAATGTAGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-3704s21c1
Sequence:CCGGGAGGACCTTCACTGCATTAAACTCGAGTTTAATGCAGTGAAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-3112s1c1
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-660s21c1
Sequence:CCGGCTCTCAGGGAAATCCGATATTCTCGAGAATATCGGATTTCCCTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015771.2-3415s21c4
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2854s21c1
Sequence:CCGGTCGCTGTGGAGACAGGTTAAACTCGAGTTTAACCTGTCTCCACAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-1748s1c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2051s21c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-332s1c1
Sequence:CCGGCCGAAGTTTGGACCTTATCAACTCGAGTTGATAAGGTCCAAACTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015771.1-2404s1c1
Sequence:CCGGCGACCTGGATGGTCATATTAACTCGAGTTAATATGACCATCCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015771
VALIDATED
LATS2 MISSION shRNA shRNA Plasmid DNA
large tumor suppressor kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2614s21c1
Sequence:CCGGCCGCTTCTACATTGCAGAGTTCTCGAGAACTCTGCAATGTAGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-3704s21c1
Sequence:CCGGGAGGACCTTCACTGCATTAAACTCGAGTTTAATGCAGTGAAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-3112s1c1
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-660s21c1
Sequence:CCGGCTCTCAGGGAAATCCGATATTCTCGAGAATATCGGATTTCCCTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015771.2-3415s21c4
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2854s21c1
Sequence:CCGGTCGCTGTGGAGACAGGTTAAACTCGAGTTTAACCTGTCTCCACAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-1748s1c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2051s21c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-332s1c1
Sequence:CCGGCCGAAGTTTGGACCTTATCAACTCGAGTTGATAAGGTCCAAACTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015771.1-2404s1c1
Sequence:CCGGCGACCTGGATGGTCATATTAACTCGAGTTAATATGACCATCCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015771
VALIDATED
LATS2 MISSION shRNA Lentiviral Transduction Particles
large tumor suppressor kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2614s21c1
Sequence:CCGGCCGCTTCTACATTGCAGAGTTCTCGAGAACTCTGCAATGTAGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-3704s21c1
Sequence:CCGGGAGGACCTTCACTGCATTAAACTCGAGTTTAATGCAGTGAAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-3112s1c1
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-660s21c1
Sequence:CCGGCTCTCAGGGAAATCCGATATTCTCGAGAATATCGGATTTCCCTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015771.2-3415s21c4
Sequence:CCGGCGCCTTCTATGAGTTCACCTTCTCGAGAAGGTGAACTCATAGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2854s21c1
Sequence:CCGGTCGCTGTGGAGACAGGTTAAACTCGAGTTTAACCTGTCTCCACAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-1748s1c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015771.2-2051s21c1
Sequence:CCGGCGCAAGAATAGCAGAGATGAACTCGAGTTCATCTCTGCTATTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015771.1-332s1c1
Sequence:CCGGCCGAAGTTTGGACCTTATCAACTCGAGTTGATAAGGTCCAAACTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015771.1-2404s1c1
Sequence:CCGGCGACCTGGATGGTCATATTAACTCGAGTTAATATGACCATCCAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014572
VALIDATED
LATS2 MISSION shRNA Bacterial Glycerol Stock
large tumor suppressor kinase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014572.1-3763s1c1
Sequence:CCGGCACTTGAAATTCTGCTCTTCACTCGAGTGAAGAGCAGAATTTCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-458s1c1
Sequence:CCGGGCCATCCAAGTCTTCGGTTCACTCGAGTGAACCGAAGACTTGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2162s1c1
Sequence:CCGGCTACTCGCCATACGCCTTTAACTCGAGTTAAAGGCGTATGGCGAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-3750s1c1
Sequence:CCGGCCGTCGATTACTTCACTTGAACTCGAGTTCAAGTGAAGTAATCGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-490s1c1
Sequence:CCGGCAGGACCAAACAGTGACACTTCTCGAGAAGTGTCACTGTTTGGTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2457s1c1
Sequence:CCGGGCCATGAAGACCCTAAGGAAACTCGAGTTTCCTTAGGGTCTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-575s1c1
Sequence:CCGGCCCAAAGTTCGGACCTTATCACTCGAGTGATAAGGTCCGAACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2894s1c1
Sequence:CCGGCCTCTGGGATGATGTGTCTAACTCGAGTTAGACACATCATCCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-815s1c1
Sequence:CCGGGCAGATTGTGCGGGTCATTAACTCGAGTTAATGACCCGCACAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014572
VALIDATED
LATS2 MISSION shRNA shRNA Plasmid DNA
large tumor suppressor kinase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014572.1-3763s1c1
Sequence:CCGGCACTTGAAATTCTGCTCTTCACTCGAGTGAAGAGCAGAATTTCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-458s1c1
Sequence:CCGGGCCATCCAAGTCTTCGGTTCACTCGAGTGAACCGAAGACTTGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2162s1c1
Sequence:CCGGCTACTCGCCATACGCCTTTAACTCGAGTTAAAGGCGTATGGCGAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-3750s1c1
Sequence:CCGGCCGTCGATTACTTCACTTGAACTCGAGTTCAAGTGAAGTAATCGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-490s1c1
Sequence:CCGGCAGGACCAAACAGTGACACTTCTCGAGAAGTGTCACTGTTTGGTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2457s1c1
Sequence:CCGGGCCATGAAGACCCTAAGGAAACTCGAGTTTCCTTAGGGTCTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-575s1c1
Sequence:CCGGCCCAAAGTTCGGACCTTATCACTCGAGTGATAAGGTCCGAACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2894s1c1
Sequence:CCGGCCTCTGGGATGATGTGTCTAACTCGAGTTAGACACATCATCCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-815s1c1
Sequence:CCGGGCAGATTGTGCGGGTCATTAACTCGAGTTAATGACCCGCACAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014572
VALIDATED
LATS2 MISSION shRNA Lentiviral Transduction Particles
large tumor suppressor kinase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014572.1-3763s1c1
Sequence:CCGGCACTTGAAATTCTGCTCTTCACTCGAGTGAAGAGCAGAATTTCAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-458s1c1
Sequence:CCGGGCCATCCAAGTCTTCGGTTCACTCGAGTGAACCGAAGACTTGGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2162s1c1
Sequence:CCGGCTACTCGCCATACGCCTTTAACTCGAGTTAAAGGCGTATGGCGAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-3750s1c1
Sequence:CCGGCCGTCGATTACTTCACTTGAACTCGAGTTCAAGTGAAGTAATCGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-490s1c1
Sequence:CCGGCAGGACCAAACAGTGACACTTCTCGAGAAGTGTCACTGTTTGGTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2457s1c1
Sequence:CCGGGCCATGAAGACCCTAAGGAAACTCGAGTTTCCTTAGGGTCTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-575s1c1
Sequence:CCGGCCCAAAGTTCGGACCTTATCACTCGAGTGATAAGGTCCGAACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014572.x-2894s1c1
Sequence:CCGGCCTCTGGGATGATGTGTCTAACTCGAGTTAGACACATCATCCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014572.1-815s1c1
Sequence:CCGGGCAGATTGTGCGGGTCATTAACTCGAGTTAATGACCCGCACAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)