EMAIL THIS PAGE TO A FRIEND

LAX1

lymphocyte transmembrane adaptor 1

58 Gene Product Result for
Synonyms: LAX
UniProtKB ID: Q8IWV1, B7Z744, J3KP69, Q6NSZ6, Q9NXB4
Gene ID:
Mouse(240754) lymphocyte transmembrane adaptor 1
Rat(498232) lymphocyte transmembrane adaptor 1
Thale Cress(831866) auxin transporter-like protein 1
dog(100684578) lymphocyte transmembrane adaptor 1
domestic cat(101082716) lymphocyte transmembrane adaptor 1
cow(540424) lymphocyte transmembrane adaptor 1
sheep(101116496) lymphocyte transmembrane adaptor 1
domestic guinea pig(100721170) lymphocyte transmembrane adaptor 1
naked mole-rat(101699294) lymphocyte transmembrane adaptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017773 Rosetta Predictions human pricing
NM_001017491 Rosetta Predictions rat pricing
NM_172842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173436 predicted 1126
2 SASI_Hs01_00173437 predicted 1636
3 SASI_Hs01_00173438 predicted 565
4 SASI_Hs01_00173439 predicted 1445
5 SASI_Hs01_00173440 predicted 1438
6 SASI_Hs01_00173441 predicted 590
7 SASI_Hs01_00173442 predicted 1330
8 SASI_Hs01_00173443 predicted 903
9 SASI_Hs01_00173445 predicted 833
10 SASI_Hs02_00350611 predicted 1572
11 SASI_Hs01_00173444 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046240 predicted 535
2 SASI_Rn01_00046241 predicted 1320
3 SASI_Rn01_00046242 predicted 1664
4 SASI_Rn01_00046243 predicted 1244
5 SASI_Rn01_00046244 predicted 835
6 SASI_Rn02_00202307 predicted 425
7 SASI_Rn01_00046246 predicted 776
8 SASI_Rn01_00046247 predicted 1310
9 SASI_Rn01_00046249 predicted 1539
10 SASI_Rn02_00202308 predicted 1297
11 SASI_Rn01_00046245 predicted 479
12 SASI_Rn01_00046248 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114411 predicted 690
2 SASI_Mm02_00344775 predicted 894
3 SASI_Mm01_00114413 predicted 1048
4 SASI_Mm01_00114414 predicted 595
5 SASI_Mm01_00114415 predicted 1198
6 SASI_Mm01_00114417 predicted 1262
7 SASI_Mm01_00114418 predicted 1349
8 SASI_Mm02_00344776 predicted 1622
9 SASI_Mm01_00114419 predicted 476
10 SASI_Mm01_00114420 predicted 474
11 SASI_Mm01_00114412 predicted 795
12 SASI_Mm01_00114416 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172842
LAX1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte transmembrane adaptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1749s1c1
Sequence:CCGGGAAAGTAATCAGGGTCACAAACTCGAGTTTGTGACCCTGATTACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-597s1c1
Sequence:CCGGGAGACATCAGTTGAGTGGTTTCTCGAGAAACCACTCAACTGATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-898s1c1
Sequence:CCGGCGCATAGAAAGCACTCCTGAACTCGAGTTCAGGAGTGCTTTCTATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-1053s1c1
Sequence:CCGGCGATTTATCTCAGACTTCAAACTCGAGTTTGAAGTCTGAGATAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-886s1c1
Sequence:CCGGGAGACTCTAACTCGCATAGAACTCGAGTTCTATGCGAGTTAGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1898s1c1
Sequence:CCGGGGTGGATTACAGATCAGATACCTCGAGGTATCTGATCTGTAATCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-493s1c1
Sequence:CCGGCCTGTTTCTTACTTCCAAGTACTCGAGTACTTGGAAGTAAGAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1959s1c1
Sequence:CCGGCTACTTTCAATGTGTACAAATCTCGAGATTTGTACACATTGAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172842
LAX1 MISSION shRNA shRNA Plasmid DNA
lymphocyte transmembrane adaptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1749s1c1
Sequence:CCGGGAAAGTAATCAGGGTCACAAACTCGAGTTTGTGACCCTGATTACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-597s1c1
Sequence:CCGGGAGACATCAGTTGAGTGGTTTCTCGAGAAACCACTCAACTGATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-898s1c1
Sequence:CCGGCGCATAGAAAGCACTCCTGAACTCGAGTTCAGGAGTGCTTTCTATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-1053s1c1
Sequence:CCGGCGATTTATCTCAGACTTCAAACTCGAGTTTGAAGTCTGAGATAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-886s1c1
Sequence:CCGGGAGACTCTAACTCGCATAGAACTCGAGTTCTATGCGAGTTAGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1898s1c1
Sequence:CCGGGGTGGATTACAGATCAGATACCTCGAGGTATCTGATCTGTAATCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-493s1c1
Sequence:CCGGCCTGTTTCTTACTTCCAAGTACTCGAGTACTTGGAAGTAAGAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1959s1c1
Sequence:CCGGCTACTTTCAATGTGTACAAATCTCGAGATTTGTACACATTGAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172842
LAX1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte transmembrane adaptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1749s1c1
Sequence:CCGGGAAAGTAATCAGGGTCACAAACTCGAGTTTGTGACCCTGATTACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-597s1c1
Sequence:CCGGGAGACATCAGTTGAGTGGTTTCTCGAGAAACCACTCAACTGATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-898s1c1
Sequence:CCGGCGCATAGAAAGCACTCCTGAACTCGAGTTCAGGAGTGCTTTCTATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-1053s1c1
Sequence:CCGGCGATTTATCTCAGACTTCAAACTCGAGTTTGAAGTCTGAGATAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-886s1c1
Sequence:CCGGGAGACTCTAACTCGCATAGAACTCGAGTTCTATGCGAGTTAGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1898s1c1
Sequence:CCGGGGTGGATTACAGATCAGATACCTCGAGGTATCTGATCTGTAATCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172842.2-493s1c1
Sequence:CCGGCCTGTTTCTTACTTCCAAGTACTCGAGTACTTGGAAGTAAGAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172842.2-1959s1c1
Sequence:CCGGCTACTTTCAATGTGTACAAATCTCGAGATTTGTACACATTGAAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017773
LAX1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte transmembrane adaptor 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-900s1c1
Sequence:CCGGGAGAAAGATGTGCCATCCTCACTCGAGTGAGGATGGCACATCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-525s1c1
Sequence:CCGGGTTTCTTCAGAGGATTCGCATCTCGAGATGCGAATCCTCTGAAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1035s1c1
Sequence:CCGGGAGGACAGTCAGATGAAACATCTCGAGATGTTTCATCTGACTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-386s1c1
Sequence:CCGGCCAGGAGCATACAGCCCACATCTCGAGATGTGGGCTGTATGCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-537s1c1
Sequence:CCGGGATTCGCATGATTATGTCAATCTCGAGATTGACATAATCATGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1053s1c1
Sequence:CCGGCATAGAGAAGAGATGTCAAATCTCGAGATTTGACATCTCTTCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-483s1c1
Sequence:CCGGGCACACTGCATCAATGTCAGACTCGAGTCTGACATTGATGCAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-519s1c1
Sequence:CCGGGCAAGCGTTTCTTCAGAGGATCTCGAGATCCTCTGAAGAAACGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-284s1c1
Sequence:CCGGGAGACATGAGTCGAGGAGTATCTCGAGATACTCCTCGACTCATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-606s1c1
Sequence:CCGGCCTTCCAGAAATCTCTTTGTTCTCGAGAACAAAGAGATTTCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-529s1c1
Sequence:CCGGCTTCAGAGGATTCGCATGATTCTCGAGAATCATGCGAATCCTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-723s1c1
Sequence:CCGGGACAGTGATTCACTCAGCAATCTCGAGATTGCTGAGTGAATCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-613s1c1
Sequence:CCGGGAAATCTCTTTGTTCTTCCCACTCGAGTGGGAAGAACAAAGAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017773
LAX1 MISSION shRNA shRNA Plasmid DNA
lymphocyte transmembrane adaptor 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-900s1c1
Sequence:CCGGGAGAAAGATGTGCCATCCTCACTCGAGTGAGGATGGCACATCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-525s1c1
Sequence:CCGGGTTTCTTCAGAGGATTCGCATCTCGAGATGCGAATCCTCTGAAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1035s1c1
Sequence:CCGGGAGGACAGTCAGATGAAACATCTCGAGATGTTTCATCTGACTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-386s1c1
Sequence:CCGGCCAGGAGCATACAGCCCACATCTCGAGATGTGGGCTGTATGCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-537s1c1
Sequence:CCGGGATTCGCATGATTATGTCAATCTCGAGATTGACATAATCATGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1053s1c1
Sequence:CCGGCATAGAGAAGAGATGTCAAATCTCGAGATTTGACATCTCTTCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-483s1c1
Sequence:CCGGGCACACTGCATCAATGTCAGACTCGAGTCTGACATTGATGCAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-519s1c1
Sequence:CCGGGCAAGCGTTTCTTCAGAGGATCTCGAGATCCTCTGAAGAAACGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-284s1c1
Sequence:CCGGGAGACATGAGTCGAGGAGTATCTCGAGATACTCCTCGACTCATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-606s1c1
Sequence:CCGGCCTTCCAGAAATCTCTTTGTTCTCGAGAACAAAGAGATTTCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-529s1c1
Sequence:CCGGCTTCAGAGGATTCGCATGATTCTCGAGAATCATGCGAATCCTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-723s1c1
Sequence:CCGGGACAGTGATTCACTCAGCAATCTCGAGATTGCTGAGTGAATCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-613s1c1
Sequence:CCGGGAAATCTCTTTGTTCTTCCCACTCGAGTGGGAAGAACAAAGAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017773
LAX1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte transmembrane adaptor 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-900s1c1
Sequence:CCGGGAGAAAGATGTGCCATCCTCACTCGAGTGAGGATGGCACATCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-525s1c1
Sequence:CCGGGTTTCTTCAGAGGATTCGCATCTCGAGATGCGAATCCTCTGAAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1035s1c1
Sequence:CCGGGAGGACAGTCAGATGAAACATCTCGAGATGTTTCATCTGACTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-386s1c1
Sequence:CCGGCCAGGAGCATACAGCCCACATCTCGAGATGTGGGCTGTATGCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-537s1c1
Sequence:CCGGGATTCGCATGATTATGTCAATCTCGAGATTGACATAATCATGCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-1053s1c1
Sequence:CCGGCATAGAGAAGAGATGTCAAATCTCGAGATTTGACATCTCTTCTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-483s1c1
Sequence:CCGGGCACACTGCATCAATGTCAGACTCGAGTCTGACATTGATGCAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-519s1c1
Sequence:CCGGGCAAGCGTTTCTTCAGAGGATCTCGAGATCCTCTGAAGAAACGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-284s1c1
Sequence:CCGGGAGACATGAGTCGAGGAGTATCTCGAGATACTCCTCGACTCATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-606s1c1
Sequence:CCGGCCTTCCAGAAATCTCTTTGTTCTCGAGAACAAAGAGATTTCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-529s1c1
Sequence:CCGGCTTCAGAGGATTCGCATGATTCTCGAGAATCATGCGAATCCTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-723s1c1
Sequence:CCGGGACAGTGATTCACTCAGCAATCTCGAGATTGCTGAGTGAATCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017773.1-613s1c1
Sequence:CCGGGAAATCTCTTTGTTCTTCCCACTCGAGTGGGAAGAACAAAGAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)