EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0706 Human LAYN / Layilin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103541 MISSION® esiRNA esiRNA human LAYN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178834 Rosetta Predictions human pricing
XM_001071139 Rosetta Predictions rat pricing
XM_576410 Rosetta Predictions rat pricing
XM_146887 Rosetta Predictions mouse pricing
XM_917279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115149 predicted 1367
2 SASI_Hs01_00115150 predicted 998
3 SASI_Hs01_00115151 predicted 1362
4 SASI_Hs01_00115152 predicted 925
5 SASI_Hs02_00369883 predicted 1359
6 SASI_Hs01_00115153 predicted 465
7 SASI_Hs01_00115154 predicted 821
8 SASI_Hs01_00115155 predicted 466
9 SASI_Hs01_00115156 predicted 467
10 SASI_Hs01_00115157 predicted 1156
11 SASI_Hs01_00115148 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334010 predicted 352
2 SASI_Rn02_00334011 predicted 456
3 SASI_Rn02_00334012 predicted 519
4 SASI_Rn02_00334013 predicted 509
5 SASI_Rn02_00334014 predicted 550
6 SASI_Rn02_00334015 predicted 712
7 SASI_Rn02_00334016 predicted 264
8 SASI_Rn02_00334017 predicted 766
9 SASI_Rn02_00334018 predicted 778
10 SASI_Rn02_00334019 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405271 predicted 801
2 SASI_Rn02_00405272 predicted 905
3 SASI_Rn02_00405273 predicted 971
4 SASI_Rn02_00405274 predicted 958
5 SASI_Rn02_00405275 predicted 988
6 SASI_Rn02_00405276 predicted 1159
7 SASI_Rn02_00405277 predicted 714
8 SASI_Rn02_00405278 predicted 1213
9 SASI_Rn02_00405279 predicted 1225
10 SASI_Rn02_00405280 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425322 predicted 1284
2 SASI_Mm02_00425323 predicted 1232
3 SASI_Mm02_00425324 predicted 1273
4 SASI_Mm02_00425325 predicted 1258
5 SASI_Mm02_00425326 predicted 1174
6 SASI_Mm02_00425327 predicted 1082
7 SASI_Mm02_00425328 predicted 1248
8 SASI_Mm02_00425329 predicted 1189
9 SASI_Mm02_00425330 predicted 1074
10 SASI_Mm02_00425331 predicted 1149
11 SASI_Mm01_00218040 predicted 904
12 SASI_Mm01_00218041 predicted 706
13 SASI_Mm01_00218042 predicted 763
14 SASI_Mm01_00218043 predicted 786
15 SASI_Mm01_00218044 predicted 830
16 SASI_Mm01_00218045 predicted 739
17 SASI_Mm01_00218046 predicted 746
18 SASI_Mm01_00218047 predicted 802
19 SASI_Mm01_00218048 predicted 899
20 SASI_Mm01_00218049 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441015 predicted 386
2 SASI_Mm02_00441016 predicted 745
3 SASI_Mm02_00441017 predicted 759
4 SASI_Mm02_00441018 predicted 548
5 SASI_Mm02_00441019 predicted 676
6 SASI_Mm02_00441020 predicted 484
7 SASI_Mm02_00441021 predicted 556
8 SASI_Mm02_00441022 predicted 296
9 SASI_Mm02_00441023 predicted 854
10 SASI_Mm02_00441024 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178834
VALIDATED
LAYN MISSION shRNA Bacterial Glycerol Stock
layilin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1547s21c1
Sequence:CCGGGGTCTATGAACAAGCTTAGATCTCGAGATCTAAGCTTGTTCATAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1721s21c1
Sequence:CCGGTTGGTTGGTTGTATCTAACTTCTCGAGAAGTTAGATACAACCAACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1005s21c1
Sequence:CCGGGAATCTGGCCTACATCCTAATCTCGAGATTAGGATGTAGGCCAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1367s21c1
Sequence:CCGGGATTTGTGACCAATGACATTTCTCGAGAAATGTCATTGGTCACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-497s1c1
Sequence:CCGGCTGAACTTTGAGGAAGCCAAACTCGAGTTTGGCTTCCTCAAAGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-698s1c1
Sequence:CCGGGATGGCAGCATATCACAATTTCTCGAGAAATTGTGATATGCTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1177s1c1
Sequence:CCGGCCTAGAGGTCTACAATGTCATCTCGAGATGACATTGTAGACCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-836s1c1
Sequence:CCGGCGGTGCAACATGAAGAACAATCTCGAGATTGTTCTTCATGTTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1062s1c1
Sequence:CCGGCCACAGTTGTATGTTGGGTTTCTCGAGAAACCCAACATACAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178834
VALIDATED
LAYN MISSION shRNA shRNA Plasmid DNA
layilin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1547s21c1
Sequence:CCGGGGTCTATGAACAAGCTTAGATCTCGAGATCTAAGCTTGTTCATAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1721s21c1
Sequence:CCGGTTGGTTGGTTGTATCTAACTTCTCGAGAAGTTAGATACAACCAACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1005s21c1
Sequence:CCGGGAATCTGGCCTACATCCTAATCTCGAGATTAGGATGTAGGCCAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1367s21c1
Sequence:CCGGGATTTGTGACCAATGACATTTCTCGAGAAATGTCATTGGTCACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-497s1c1
Sequence:CCGGCTGAACTTTGAGGAAGCCAAACTCGAGTTTGGCTTCCTCAAAGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-698s1c1
Sequence:CCGGGATGGCAGCATATCACAATTTCTCGAGAAATTGTGATATGCTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1177s1c1
Sequence:CCGGCCTAGAGGTCTACAATGTCATCTCGAGATGACATTGTAGACCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-836s1c1
Sequence:CCGGCGGTGCAACATGAAGAACAATCTCGAGATTGTTCTTCATGTTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1062s1c1
Sequence:CCGGCCACAGTTGTATGTTGGGTTTCTCGAGAAACCCAACATACAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178834
VALIDATED
LAYN MISSION shRNA Lentiviral Transduction Particles
layilin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1547s21c1
Sequence:CCGGGGTCTATGAACAAGCTTAGATCTCGAGATCTAAGCTTGTTCATAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178834.3-1721s21c1
Sequence:CCGGTTGGTTGGTTGTATCTAACTTCTCGAGAAGTTAGATACAACCAACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1005s21c1
Sequence:CCGGGAATCTGGCCTACATCCTAATCTCGAGATTAGGATGTAGGCCAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178834.3-1367s21c1
Sequence:CCGGGATTTGTGACCAATGACATTTCTCGAGAAATGTCATTGGTCACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-497s1c1
Sequence:CCGGCTGAACTTTGAGGAAGCCAAACTCGAGTTTGGCTTCCTCAAAGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-698s1c1
Sequence:CCGGGATGGCAGCATATCACAATTTCTCGAGAAATTGTGATATGCTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1177s1c1
Sequence:CCGGCCTAGAGGTCTACAATGTCATCTCGAGATGACATTGTAGACCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-836s1c1
Sequence:CCGGCGGTGCAACATGAAGAACAATCTCGAGATTGTTCTTCATGTTGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178834.2-1062s1c1
Sequence:CCGGCCACAGTTGTATGTTGGGTTTCTCGAGAAACCCAACATACAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033534
LAYN MISSION shRNA Bacterial Glycerol Stock
layilin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-257s21c1
Sequence:CCGGACACGGAGGCCTTGCTATAAACTCGAGTTTATAGCAAGGCCTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-674s21c1
Sequence:CCGGTGCAAATATCATGACGATAAACTCGAGTTTATCGTCATGATATTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-696s21c1
Sequence:CCGGCAAGTACAACACCCTCTATTTCTCGAGAAATAGAGGGTGTTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033534.1-1305s21c1
Sequence:CCGGGAAGCAAAGGCCTCCGATTTCCTCGAGGAAATCGGAGGCCTTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-820s21c1
Sequence:CCGGGAATCTTGCCTACATCCTAATCTCGAGATTAGGATGTAGGCAAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033534
LAYN MISSION shRNA shRNA Plasmid DNA
layilin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-257s21c1
Sequence:CCGGACACGGAGGCCTTGCTATAAACTCGAGTTTATAGCAAGGCCTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-674s21c1
Sequence:CCGGTGCAAATATCATGACGATAAACTCGAGTTTATCGTCATGATATTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-696s21c1
Sequence:CCGGCAAGTACAACACCCTCTATTTCTCGAGAAATAGAGGGTGTTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033534.1-1305s21c1
Sequence:CCGGGAAGCAAAGGCCTCCGATTTCCTCGAGGAAATCGGAGGCCTTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-820s21c1
Sequence:CCGGGAATCTTGCCTACATCCTAATCTCGAGATTAGGATGTAGGCAAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033534
LAYN MISSION shRNA Lentiviral Transduction Particles
layilin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-257s21c1
Sequence:CCGGACACGGAGGCCTTGCTATAAACTCGAGTTTATAGCAAGGCCTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-674s21c1
Sequence:CCGGTGCAAATATCATGACGATAAACTCGAGTTTATCGTCATGATATTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-696s21c1
Sequence:CCGGCAAGTACAACACCCTCTATTTCTCGAGAAATAGAGGGTGTTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033534.1-1305s21c1
Sequence:CCGGGAAGCAAAGGCCTCCGATTTCCTCGAGGAAATCGGAGGCCTTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033534.1-820s21c1
Sequence:CCGGGAATCTTGCCTACATCCTAATCTCGAGATTAGGATGTAGGCAAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)