EMAIL THIS PAGE TO A FRIEND

LBH

limb bud and heart development

44 Gene Product Result for
UniProtKB ID: Q53QV2, B2RBC2, Q9H0Q1
Gene ID:
Mouse(77889) limb-bud and heart
Rat(683626) limb bud and heart development
chicken(421301) limb bud and heart development homolog (mouse)
cow(616148) limb bud and heart development homolog (mouse)
domestic cat(101090433) limb bud and heart development homolog (mouse)
dog(611237) limb bud and heart development homolog (mouse)
sheep(101103634) limb bud and heart development homolog (mouse)
domestic guinea pig(100729824) limb bud and heart development
naked mole-rat(101705087) limb bud and heart development
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030915 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227561 MISSION® esiRNA esiRNA targeting human LBH human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030915 Rosetta Predictions human pricing
NM_001129880 Rosetta Predictions rat pricing
NM_029999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099186 predicted 244
2 SASI_Hs01_00099187 predicted 553
3 SASI_Hs01_00099188 predicted 516
4 SASI_Hs01_00099189 predicted 311
5 SASI_Hs01_00099190 predicted 479
6 SASI_Hs01_00099191 predicted 713
7 SASI_Hs02_00358455 predicted 1012
8 SASI_Hs02_00358456 predicted 483
9 SASI_Hs01_00099192 predicted 232
10 SASI_Hs01_00099193 predicted 622
11 SASI_Hs01_00099194 predicted 607
12 SASI_Hs01_00099195 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255229 predicted 568
2 SASI_Rn02_00255230 predicted 635
3 SASI_Rn02_00255231 predicted 749
4 SASI_Rn02_00255232 predicted 257
5 SASI_Rn02_00255233 predicted 747
6 SASI_Rn02_00255234 predicted 321
7 SASI_Rn02_00255235 predicted 567
8 SASI_Rn02_00255236 predicted 248
9 SASI_Rn02_00255237 predicted 254
10 SASI_Rn02_00255238 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189109 predicted 245
2 SASI_Mm01_00189110 predicted 500
3 SASI_Mm01_00189111 predicted 747
4 SASI_Mm01_00189112 predicted 329
5 SASI_Mm01_00189113 predicted 367
6 SASI_Mm01_00189114 predicted 338
7 SASI_Mm01_00189115 predicted 367
8 SASI_Mm01_00189116 predicted 376
9 SASI_Mm01_00189117 predicted 846
10 SASI_Mm01_00189118 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029999
LBH MISSION shRNA Bacterial Glycerol Stock
limb bud and heart development
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029999.4-948s21c1
Sequence:CCGGGTGAGCAAATGAGCAAGAAAGCTCGAGCTTTCTTGCTCATTTGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-261s1c1
Sequence:CCGGCTATCTGAGATCGGCTGAGATCTCGAGATCTCAGCCGATCTCAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-496s1c1
Sequence:CCGGGATGAGCAAGACAACTGTGAACTCGAGTTCACAGTTGTCTTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-301s1c1
Sequence:CCGGGCTCCATCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-334s1c1
Sequence:CCGGCGCAAGGATGGCCTTTCCTATCTCGAGATAGGAAAGGCCATCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029999.3-1832s1c1
Sequence:CCGGCCTTGTAGAATAGCAGCCTTTCTCGAGAAAGGCTGCTATTCTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029999.4-308s21c1
Sequence:CCGGGGTGATGATGAACGCTCCATCCTCGAGGATGGAGCGTTCATCATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029999
LBH MISSION shRNA shRNA Plasmid DNA
limb bud and heart development
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029999.4-948s21c1
Sequence:CCGGGTGAGCAAATGAGCAAGAAAGCTCGAGCTTTCTTGCTCATTTGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-261s1c1
Sequence:CCGGCTATCTGAGATCGGCTGAGATCTCGAGATCTCAGCCGATCTCAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-496s1c1
Sequence:CCGGGATGAGCAAGACAACTGTGAACTCGAGTTCACAGTTGTCTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-301s1c1
Sequence:CCGGGCTCCATCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-334s1c1
Sequence:CCGGCGCAAGGATGGCCTTTCCTATCTCGAGATAGGAAAGGCCATCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029999.3-1832s1c1
Sequence:CCGGCCTTGTAGAATAGCAGCCTTTCTCGAGAAAGGCTGCTATTCTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029999.4-308s21c1
Sequence:CCGGGGTGATGATGAACGCTCCATCCTCGAGGATGGAGCGTTCATCATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029999
LBH MISSION shRNA Lentiviral Transduction Particles
limb bud and heart development
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029999.4-948s21c1
Sequence:CCGGGTGAGCAAATGAGCAAGAAAGCTCGAGCTTTCTTGCTCATTTGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-261s1c1
Sequence:CCGGCTATCTGAGATCGGCTGAGATCTCGAGATCTCAGCCGATCTCAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-496s1c1
Sequence:CCGGGATGAGCAAGACAACTGTGAACTCGAGTTCACAGTTGTCTTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-301s1c1
Sequence:CCGGGCTCCATCCATGGAAGAGATTCTCGAGAATCTCTTCCATGGATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029999.3-334s1c1
Sequence:CCGGCGCAAGGATGGCCTTTCCTATCTCGAGATAGGAAAGGCCATCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029999.3-1832s1c1
Sequence:CCGGCCTTGTAGAATAGCAGCCTTTCTCGAGAAAGGCTGCTATTCTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029999.4-308s21c1
Sequence:CCGGGGTGATGATGAACGCTCCATCCTCGAGGATGGAGCGTTCATCATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030915
VALIDATED
LBH MISSION shRNA Bacterial Glycerol Stock
limb bud and heart development
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-604s21c1
Sequence:CCGGGAGAGTGAGCCGCAATTGTTCCTCGAGGAACAATTGCGGCTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-533s21c1
Sequence:CCGGTGTGGACTCCCATGGGTCATACTCGAGTATGACCCATGGGAGTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-2514s1c1
Sequence:CCGGGCTTGTAAACTGCGTAACAAACTCGAGTTTGTTACGCAGTTTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-480s1c1
Sequence:CCGGGATGAGCAAGATAACTGCGAACTCGAGTTCGCAGTTATCTTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-496s1c1
Sequence:CCGGGCGAAGAGACAGCGAAAGAAACTCGAGTTTCTTTCGCTGTCTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-275s1c1
Sequence:CCGGGATGATGAACACCCAGCCCATCTCGAGATGGGCTGGGTGTTCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-245s1c1
Sequence:CCGGCTATCTGAGATCGGCCAAGATCTCGAGATCTTGGCCGATCTCAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030915
VALIDATED
LBH MISSION shRNA shRNA Plasmid DNA
limb bud and heart development
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-604s21c1
Sequence:CCGGGAGAGTGAGCCGCAATTGTTCCTCGAGGAACAATTGCGGCTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-533s21c1
Sequence:CCGGTGTGGACTCCCATGGGTCATACTCGAGTATGACCCATGGGAGTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-2514s1c1
Sequence:CCGGGCTTGTAAACTGCGTAACAAACTCGAGTTTGTTACGCAGTTTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-480s1c1
Sequence:CCGGGATGAGCAAGATAACTGCGAACTCGAGTTCGCAGTTATCTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-496s1c1
Sequence:CCGGGCGAAGAGACAGCGAAAGAAACTCGAGTTTCTTTCGCTGTCTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-275s1c1
Sequence:CCGGGATGATGAACACCCAGCCCATCTCGAGATGGGCTGGGTGTTCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-245s1c1
Sequence:CCGGCTATCTGAGATCGGCCAAGATCTCGAGATCTTGGCCGATCTCAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030915
VALIDATED
LBH MISSION shRNA Lentiviral Transduction Particles
limb bud and heart development
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-604s21c1
Sequence:CCGGGAGAGTGAGCCGCAATTGTTCCTCGAGGAACAATTGCGGCTCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030915.3-533s21c1
Sequence:CCGGTGTGGACTCCCATGGGTCATACTCGAGTATGACCCATGGGAGTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-2514s1c1
Sequence:CCGGGCTTGTAAACTGCGTAACAAACTCGAGTTTGTTACGCAGTTTACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-480s1c1
Sequence:CCGGGATGAGCAAGATAACTGCGAACTCGAGTTCGCAGTTATCTTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-496s1c1
Sequence:CCGGGCGAAGAGACAGCGAAAGAAACTCGAGTTTCTTTCGCTGTCTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030915.1-275s1c1
Sequence:CCGGGATGATGAACACCCAGCCCATCTCGAGATGGGCTGGGTGTTCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030915.1-245s1c1
Sequence:CCGGCTATCTGAGATCGGCCAAGATCTCGAGATCTTGGCCGATCTCAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)