EMAIL THIS PAGE TO A FRIEND

LBP

lipopolysaccharide binding protein

109 Gene Product Result for
Synonyms: BPIFD2
UniProtKB ID: P18428, B2R938, O43438, Q92672, Q9H403, Q9UD66
Gene ID:
Human(3929) Summary: The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]
Mouse(16803) lipopolysaccharide binding protein
Rat(29469) lipopolysaccharide binding protein
sheep(101104595) lipopolysaccharide binding protein
Domestic Rabbit(100009124) lipopolysaccharide binding protein
domestic guinea pig(100731373) lipopolysaccharide binding protein
naked mole-rat(101697726) lipopolysaccharide binding protein
cow(512242) lipopolysaccharide binding protein
Horse(100070103) lipopolysaccharide binding protein
dog(485869) lipopolysaccharide binding protein
domestic cat(101097963) lipopolysaccharide binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0531 AQUA Peptide VQLYDLGLQIH[K] human pricing
AQ0532 AQUA Peptide I(CM-Cys)EMIQ[K] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004139 Rosetta Predictions human pricing
NM_017208 Rosetta Predictions rat pricing
XM_579400 Rosetta Predictions rat pricing
NM_008489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336992 predicted 702
2 SASI_Hs01_00012594 predicted 663
3 SASI_Hs01_00012596 predicted 676
4 SASI_Hs01_00012597 predicted 391
5 SASI_Hs01_00012598 predicted 946
6 SASI_Hs02_00336993 predicted 1077
7 SASI_Hs01_00012599 predicted 257
8 SASI_Hs01_00012600 predicted 486
9 SASI_Hs01_00012601 predicted 773
10 SASI_Hs01_00012602 predicted 1282
11 SASI_Hs01_00012595 predicted 937
12 SASI_Hs01_00012603 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093499 predicted 1063
2 SASI_Rn01_00093500 predicted 1426
3 SASI_Rn01_00093501 predicted 514
4 SASI_Rn01_00093502 predicted 1378
5 SASI_Rn02_00261567 predicted 593
6 SASI_Rn01_00093503 predicted 688
7 SASI_Rn01_00093505 predicted 842
8 SASI_Rn01_00093506 predicted 511
9 SASI_Rn01_00093507 predicted 629
10 SASI_Rn02_00261568 predicted 1106
11 SASI_Rn01_00093504 predicted 616
12 SASI_Rn01_00093508 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130700 predicted 945
2 SASI_Rn01_00130701 predicted 1186
3 SASI_Rn01_00130702 predicted 1262
4 SASI_Rn01_00130703 predicted 1037
5 SASI_Rn01_00130704 predicted 1112
6 SASI_Rn01_00130705 predicted 836
7 SASI_Rn01_00130706 predicted 1394
8 SASI_Rn01_00130707 predicted 1340
9 SASI_Rn01_00130708 predicted 1385
10 SASI_Rn01_00130709 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314019 predicted 1019
2 SASI_Mm02_00314020 predicted 1080
3 SASI_Mm02_00314021 predicted 555
4 SASI_Mm02_00314022 predicted 528
5 SASI_Mm01_00156080 predicted 1325
6 SASI_Mm01_00156081 predicted 1389
7 SASI_Mm02_00314023 predicted 1583
8 SASI_Mm02_00314024 predicted 988
9 SASI_Mm02_00314025 predicted 583
10 SASI_Mm02_00314026 predicted 1690
11 SASI_Mm01_00156073 predicted 1169
12 SASI_Mm01_00156074 predicted 1030
13 SASI_Mm01_00156075 predicted 521
14 SASI_Mm01_00156076 predicted 713
15 SASI_Mm01_00156077 predicted 953
16 SASI_Mm01_00156078 predicted 971
17 SASI_Mm01_00156079 predicted 510
18 SASI_Mm01_00156082 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004139
LBP MISSION shRNA Bacterial Glycerol Stock
lipopolysaccharide binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1205s1c1
Sequence:CCGGCTTGACCTTCAATACCAGCAACTCGAGTTGCTGGTATTGAAGGTCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-766s1c1
Sequence:CCGGAGGTGATGTTTAAGGGTGAAACTCGAGTTTCACCCTTAAACATCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-390s1c1
Sequence:CCGGCGCAAGTCATTCTTCAAACTACTCGAGTAGTTTGAAGAATGACTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-711s1c1
Sequence:CCGGGCCGACATTGATTATAGCTTACTCGAGTAAGCTATAATCAATGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1316s1c1
Sequence:CCGGCCTCAACTATTACATCCTTAACTCGAGTTAAGGATGTAATAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-956s21c1
Sequence:CCGGGATACCGCCTGACTCTAATATCTCGAGATATTAGAGTCAGGCGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-1271s21c1
Sequence:CCGGAGAATCCAAAGTTGGACTATTCTCGAGAATAGTCCAACTTTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-867s21c1
Sequence:CCGGTACTTTGCCATCTCGGATTATCTCGAGATAATCCGAGATGGCAAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004139
LBP MISSION shRNA shRNA Plasmid DNA
lipopolysaccharide binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1205s1c1
Sequence:CCGGCTTGACCTTCAATACCAGCAACTCGAGTTGCTGGTATTGAAGGTCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-766s1c1
Sequence:CCGGAGGTGATGTTTAAGGGTGAAACTCGAGTTTCACCCTTAAACATCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-390s1c1
Sequence:CCGGCGCAAGTCATTCTTCAAACTACTCGAGTAGTTTGAAGAATGACTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-711s1c1
Sequence:CCGGGCCGACATTGATTATAGCTTACTCGAGTAAGCTATAATCAATGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1316s1c1
Sequence:CCGGCCTCAACTATTACATCCTTAACTCGAGTTAAGGATGTAATAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-956s21c1
Sequence:CCGGGATACCGCCTGACTCTAATATCTCGAGATATTAGAGTCAGGCGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-1271s21c1
Sequence:CCGGAGAATCCAAAGTTGGACTATTCTCGAGAATAGTCCAACTTTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-867s21c1
Sequence:CCGGTACTTTGCCATCTCGGATTATCTCGAGATAATCCGAGATGGCAAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004139
LBP MISSION shRNA Lentiviral Transduction Particles
lipopolysaccharide binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1205s1c1
Sequence:CCGGCTTGACCTTCAATACCAGCAACTCGAGTTGCTGGTATTGAAGGTCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-766s1c1
Sequence:CCGGAGGTGATGTTTAAGGGTGAAACTCGAGTTTCACCCTTAAACATCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-390s1c1
Sequence:CCGGCGCAAGTCATTCTTCAAACTACTCGAGTAGTTTGAAGAATGACTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-711s1c1
Sequence:CCGGGCCGACATTGATTATAGCTTACTCGAGTAAGCTATAATCAATGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004139.2-1316s1c1
Sequence:CCGGCCTCAACTATTACATCCTTAACTCGAGTTAAGGATGTAATAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-956s21c1
Sequence:CCGGGATACCGCCTGACTCTAATATCTCGAGATATTAGAGTCAGGCGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-1271s21c1
Sequence:CCGGAGAATCCAAAGTTGGACTATTCTCGAGAATAGTCCAACTTTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004139.2-867s21c1
Sequence:CCGGTACTTTGCCATCTCGGATTATCTCGAGATAATCCGAGATGGCAAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008489
VALIDATED
LBP MISSION shRNA Bacterial Glycerol Stock
lipopolysaccharide binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008489.1-1617s1c1
Sequence:CCGGCCGTTTGTAATTCCAGATGTACTCGAGTACATCTGGAATTACAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-1408s1c1
Sequence:CCGGCCTTAACTACTACCTTCTCAACTCGAGTTGAGAAGGTAGTAGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-802s1c1
Sequence:CCGGCCTGGGCATTGACTACAGTTTCTCGAGAAACTGTAGTCAATGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-1522s1c1
Sequence:CCGGCCGCAAGGACTTCTTATACTTCTCGAGAAGTATAAGAAGTCCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-482s1c1
Sequence:CCGGCGCAAATCCTTCCTGAAACTTCTCGAGAAGTTTCAGGAAGGATTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-1594s21c1
Sequence:CCGGGGTGCCAATGTCCAGTATATGCTCGAGCATATACTGGACATTGGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-2040s21c1
Sequence:CCGGTTAGATGCTTGCCGGAGCTGTCTCGAGACAGCTCCGGCAAGCATCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1872s21c1
Sequence:CCGGGAGACCTGGAATCACTTTAAGCTCGAGCTTAAAGTGATTCCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1992s21c1
Sequence:CCGGATCCCAGCTGAACCTCTTTATCTCGAGATAAAGAGGTTCAGCTGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-979s21c1
Sequence:CCGGAGCCTACCTGAGGACAGTAAGCTCGAGCTTACTGTCCTCAGGTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008489
VALIDATED
LBP MISSION shRNA shRNA Plasmid DNA
lipopolysaccharide binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008489.1-1617s1c1
Sequence:CCGGCCGTTTGTAATTCCAGATGTACTCGAGTACATCTGGAATTACAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-1408s1c1
Sequence:CCGGCCTTAACTACTACCTTCTCAACTCGAGTTGAGAAGGTAGTAGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-802s1c1
Sequence:CCGGCCTGGGCATTGACTACAGTTTCTCGAGAAACTGTAGTCAATGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-1522s1c1
Sequence:CCGGCCGCAAGGACTTCTTATACTTCTCGAGAAGTATAAGAAGTCCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-482s1c1
Sequence:CCGGCGCAAATCCTTCCTGAAACTTCTCGAGAAGTTTCAGGAAGGATTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-1594s21c1
Sequence:CCGGGGTGCCAATGTCCAGTATATGCTCGAGCATATACTGGACATTGGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-2040s21c1
Sequence:CCGGTTAGATGCTTGCCGGAGCTGTCTCGAGACAGCTCCGGCAAGCATCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1872s21c1
Sequence:CCGGGAGACCTGGAATCACTTTAAGCTCGAGCTTAAAGTGATTCCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1992s21c1
Sequence:CCGGATCCCAGCTGAACCTCTTTATCTCGAGATAAAGAGGTTCAGCTGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-979s21c1
Sequence:CCGGAGCCTACCTGAGGACAGTAAGCTCGAGCTTACTGTCCTCAGGTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008489
VALIDATED
LBP MISSION shRNA Lentiviral Transduction Particles
lipopolysaccharide binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008489.1-1617s1c1
Sequence:CCGGCCGTTTGTAATTCCAGATGTACTCGAGTACATCTGGAATTACAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-1408s1c1
Sequence:CCGGCCTTAACTACTACCTTCTCAACTCGAGTTGAGAAGGTAGTAGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-802s1c1
Sequence:CCGGCCTGGGCATTGACTACAGTTTCTCGAGAAACTGTAGTCAATGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008489.1-1522s1c1
Sequence:CCGGCCGCAAGGACTTCTTATACTTCTCGAGAAGTATAAGAAGTCCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008489.1-482s1c1
Sequence:CCGGCGCAAATCCTTCCTGAAACTTCTCGAGAAGTTTCAGGAAGGATTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-1594s21c1
Sequence:CCGGGGTGCCAATGTCCAGTATATGCTCGAGCATATACTGGACATTGGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-2040s21c1
Sequence:CCGGTTAGATGCTTGCCGGAGCTGTCTCGAGACAGCTCCGGCAAGCATCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1872s21c1
Sequence:CCGGGAGACCTGGAATCACTTTAAGCTCGAGCTTAAAGTGATTCCAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008489.2-1992s21c1
Sequence:CCGGATCCCAGCTGAACCTCTTTATCTCGAGATAAAGAGGTTCAGCTGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008489.2-979s21c1
Sequence:CCGGAGCCTACCTGAGGACAGTAAGCTCGAGCTTACTGTCCTCAGGTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)