EMAIL THIS PAGE TO A FRIEND

LBR

lamin B receptor

123 Gene Product Result for
Synonyms: DHCR14B LMN2R PHA TDRD18
UniProtKB ID: Q14739, B2R5P3, Q14740, Q53GU7, Q59FE6
Gene ID:
Human(3930) Summary: The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(98386) lamin B receptor
Rat(89789) lamin B receptor
Zebrafish(368360) lamin B receptor
fruit fly(37482) Lamin B receptor
cow(509348) lamin B receptor
Horse(100056997) lamin B receptor
domestic cat(101085014) lamin B receptor
dog(490391) lamin B receptor
chicken(396285) lamin B receptor
naked mole-rat(101698844) lamin B receptor
sheep(101110348) lamin B receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002296 Rosetta Predictions human pricing
NM_194442 Rosetta Predictions human pricing
NM_134453 Rosetta Predictions rat pricing
NM_133815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228975 predicted 1682
2 SASI_Hs01_00228976 predicted 564
3 SASI_Hs01_00228977 predicted 1169
4 SASI_Hs02_00333593 predicted 946
5 SASI_Hs01_00228979 predicted 1695
6 SASI_Hs01_00228980 predicted 1596
7 SASI_Hs01_00228981 predicted 1010
8 SASI_Hs01_00228982 predicted 886
9 SASI_Hs01_00228983 predicted 479
10 SASI_Hs01_00228984 predicted 1634
11 SASI_Hs01_00228978 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071363 predicted 1666
2 SASI_Hs01_00071364 predicted 542
3 SASI_Hs01_00071365 predicted 1153
4 SASI_Hs02_00371508 predicted 927
5 SASI_Hs01_00071367 predicted 1678
6 SASI_Hs01_00071368 predicted 1582
7 SASI_Hs01_00071369 predicted 997
8 SASI_Hs01_00071370 predicted 862
9 SASI_Hs01_00071371 predicted 467
10 SASI_Hs01_00071372 predicted 1620
11 SASI_Hs01_00071366 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268034 predicted 898
2 SASI_Rn01_00082642 predicted 390
3 SASI_Rn01_00082643 predicted 1564
4 SASI_Rn01_00082644 predicted 1637
5 SASI_Rn01_00082645 predicted 1560
6 SASI_Rn01_00082646 predicted 1041
7 SASI_Rn01_00082647 predicted 1471
8 SASI_Rn01_00082648 predicted 887
9 SASI_Rn01_00082649 predicted 1425
10 SASI_Rn02_00268035 predicted 1348
11 SASI_Rn01_00082640 predicted 1595
12 SASI_Rn01_00082641 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177995 predicted 1660
2 SASI_Mm01_00177996 predicted 878
3 SASI_Mm02_00338840 predicted 673
4 SASI_Mm01_00177998 predicted 986
5 SASI_Mm01_00177999 predicted 530
6 SASI_Mm01_00178000 predicted 980
7 SASI_Mm01_00178001 predicted 957
8 SASI_Mm01_00178002 predicted 1045
9 SASI_Mm01_00178003 predicted 1733
10 SASI_Mm01_00178004 predicted 561
11 SASI_Mm01_00177997 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133815
VALIDATED
LBR MISSION shRNA Bacterial Glycerol Stock
lamin B receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1803s1c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1659s1c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1240s1c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133815.1-2348s21c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-2348s1c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-159s1c1
Sequence:CCGGCGACAACAAATCCCAGCTCTACTCGAGTAGAGCTGGGATTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1240s21c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1803s21c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1659s21c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133815
VALIDATED
LBR MISSION shRNA shRNA Plasmid DNA
lamin B receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1803s1c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1659s1c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1240s1c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133815.1-2348s21c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-2348s1c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-159s1c1
Sequence:CCGGCGACAACAAATCCCAGCTCTACTCGAGTAGAGCTGGGATTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1240s21c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1803s21c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1659s21c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133815
VALIDATED
LBR MISSION shRNA Lentiviral Transduction Particles
lamin B receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1803s1c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1659s1c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-1240s1c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133815.1-2348s21c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-2348s1c1
Sequence:CCGGGCTGAAGAATAAGGGCAGATTCTCGAGAATCTGCCCTTATTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133815.1-159s1c1
Sequence:CCGGCGACAACAAATCCCAGCTCTACTCGAGTAGAGCTGGGATTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1240s21c1
Sequence:CCGGGCTTTCGATCTCAAGTTCTTTCTCGAGAAAGAACTTGAGATCGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1803s21c1
Sequence:CCGGCCTGCCATACTTCTACATTATCTCGAGATAATGTAGAAGTATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133815.1-1659s21c1
Sequence:CCGGGCTTGCACATTTGAAGACCATCTCGAGATGGTCTTCAAATGTGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002296
VALIDATED
LBR MISSION shRNA Bacterial Glycerol Stock
lamin B receptor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2022s21c1
Sequence:CCGGTGCAATTCCAGCTGCCATTTGCTCGAGCAAATGGCAGCTGGAATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1256s1c1
Sequence:CCGGCCGTGAATTAAACCCTCGAATCTCGAGATTCGAGGGTTTAATTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-548s1c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002296.2-1647s1c1
Sequence:CCGGCGAGGTGCAAATTCTCAGAAACTCGAGTTTCTGAGAATTTGCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1717s21c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1717s1c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2153s21c1
Sequence:CCGGATAGCCGTGTTTACTTGTATTCTCGAGAATACAAGTAAACACGGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-1321s21c1
Sequence:CCGGTGATTGGATGGGTGGTTATTACTCGAGTAATAACCACCCATCCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-548s21c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1954s21c1
Sequence:CCGGAGCGTGTGCCCTACCGTATATCTCGAGATATACGGTAGGGCACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-443s21c1
Sequence:CCGGTTCCCACCAGGCCGACATTAACTCGAGTTAATGTCGGCCTGGTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002296
VALIDATED
LBR MISSION shRNA shRNA Plasmid DNA
lamin B receptor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2022s21c1
Sequence:CCGGTGCAATTCCAGCTGCCATTTGCTCGAGCAAATGGCAGCTGGAATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1256s1c1
Sequence:CCGGCCGTGAATTAAACCCTCGAATCTCGAGATTCGAGGGTTTAATTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-548s1c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002296.2-1647s1c1
Sequence:CCGGCGAGGTGCAAATTCTCAGAAACTCGAGTTTCTGAGAATTTGCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1717s21c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1717s1c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2153s21c1
Sequence:CCGGATAGCCGTGTTTACTTGTATTCTCGAGAATACAAGTAAACACGGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-1321s21c1
Sequence:CCGGTGATTGGATGGGTGGTTATTACTCGAGTAATAACCACCCATCCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-548s21c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1954s21c1
Sequence:CCGGAGCGTGTGCCCTACCGTATATCTCGAGATATACGGTAGGGCACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-443s21c1
Sequence:CCGGTTCCCACCAGGCCGACATTAACTCGAGTTAATGTCGGCCTGGTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002296
VALIDATED
LBR MISSION shRNA Lentiviral Transduction Particles
lamin B receptor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2022s21c1
Sequence:CCGGTGCAATTCCAGCTGCCATTTGCTCGAGCAAATGGCAGCTGGAATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1256s1c1
Sequence:CCGGCCGTGAATTAAACCCTCGAATCTCGAGATTCGAGGGTTTAATTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-548s1c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002296.2-1647s1c1
Sequence:CCGGCGAGGTGCAAATTCTCAGAAACTCGAGTTTCTGAGAATTTGCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1717s21c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002296.2-1717s1c1
Sequence:CCGGCCATTCATACTTCAACGGGAACTCGAGTTCCCGTTGAAGTATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-2153s21c1
Sequence:CCGGATAGCCGTGTTTACTTGTATTCTCGAGAATACAAGTAAACACGGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-1321s21c1
Sequence:CCGGTGATTGGATGGGTGGTTATTACTCGAGTAATAACCACCCATCCAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-548s21c1
Sequence:CCGGGCCTGAGCATATTGAGAGAAACTCGAGTTTCTCTCAATATGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002296.2-1954s21c1
Sequence:CCGGAGCGTGTGCCCTACCGTATATCTCGAGATATACGGTAGGGCACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002296.2-443s21c1
Sequence:CCGGTTCCCACCAGGCCGACATTAACTCGAGTTAATGTCGGCCTGGTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)