EMAIL THIS PAGE TO A FRIEND

LBX1

ladybird homeobox 1

60 Gene Product Result for
Synonyms: HPX-6 HPX6 LBX1H homeobox
UniProtKB ID: P52954, B9EGA2, Q05BB2
Gene ID:
Human(10660) Summary: This gene and the orthologous mouse gene were found by their homology to the Drosophila lady bird early and late homeobox genes. In the mouse, this gene is a key regulator of muscle precursor cell migration and is required for the acquisition of dorsal identities of forelimb muscles. [provided by RefSeq, Jul 2008]
Mouse(16814) ladybird homeobox homolog 1 (Drosophila)
Rat(499362) ladybird homeobox 1
sheep(101113186) ladybird homeobox 1
domestic guinea pig(100722466) ladybird homeobox 1
naked mole-rat(101726006) ladybird homeobox 1
chicken(100431103) ladybird homeobox 1
dog(486850) ladybird homeobox 1
cow(534470) ladybird homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006562 Rosetta Predictions human pricing
NM_001047108 Rosetta Predictions rat pricing
NM_010691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341834 predicted 631
2 SASI_Hs01_00045180 predicted 666
3 SASI_Hs01_00045181 predicted 538
4 SASI_Hs01_00045182 predicted 704
5 SASI_Hs01_00045183 predicted 541
6 SASI_Hs01_00045184 predicted 536
7 SASI_Hs01_00045185 predicted 707
8 SASI_Hs01_00045186 predicted 661
9 SASI_Hs01_00045187 predicted 639
10 SASI_Hs01_00045188 predicted 473
11 SASI_Hs01_00045179 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205995 predicted 407
2 SASI_Rn02_00205996 predicted 393
3 SASI_Rn02_00205997 predicted 392
4 SASI_Rn02_00205998 predicted 328
5 SASI_Rn02_00205999 predicted 224
6 SASI_Rn02_00206000 predicted 381
7 SASI_Rn02_00206001 predicted 358
8 SASI_Rn02_00206002 predicted 385
9 SASI_Rn02_00206003 predicted 424
10 SASI_Rn02_00206004 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192192 predicted 411
2 SASI_Mm01_00192193 predicted 419
3 SASI_Mm01_00192194 predicted 430
4 SASI_Mm01_00192195 predicted 338
5 SASI_Mm01_00192196 predicted 429
6 SASI_Mm01_00192197 predicted 455
7 SASI_Mm01_00192198 predicted 424
8 SASI_Mm01_00192199 predicted 428
9 SASI_Mm01_00192200 predicted 394
10 SASI_Mm01_00192201 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006562
LBX1 MISSION shRNA Bacterial Glycerol Stock
ladybird homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006562.3-1129s1c1
Sequence:CCGGCTCTTCCCTCTCGAAGCAATACTCGAGTATTGCTTCGAGAGGGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-408s1c1
Sequence:CCGGGCTCGCCAGCAAGACGTTTAACTCGAGTTAAACGTCTTGCTGGCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-636s1c1
Sequence:CCGGCGCGCAAGTCATCACCTGGTTCTCGAGAACCAGGTGATGACTTGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-564s1c1
Sequence:CCGGGCGCTTTCTATACCAGAAGTACTCGAGTACTTCTGGTATAGAAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-466s1c1
Sequence:CCGGCGCGACGGTATGACCATCTTTCTCGAGAAAGATGGTCATACCGTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-279s21c1
Sequence:CCGGCGTCTGTGCGGAGAAGTTACTCTCGAGAGTAACTTCTCCGCACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-256s21c1
Sequence:CCGGCATCGAGGACATCCTCAACAACTCGAGTTGTTGAGGATGTCCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006562
LBX1 MISSION shRNA shRNA Plasmid DNA
ladybird homeobox 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006562.3-1129s1c1
Sequence:CCGGCTCTTCCCTCTCGAAGCAATACTCGAGTATTGCTTCGAGAGGGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-408s1c1
Sequence:CCGGGCTCGCCAGCAAGACGTTTAACTCGAGTTAAACGTCTTGCTGGCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-636s1c1
Sequence:CCGGCGCGCAAGTCATCACCTGGTTCTCGAGAACCAGGTGATGACTTGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-564s1c1
Sequence:CCGGGCGCTTTCTATACCAGAAGTACTCGAGTACTTCTGGTATAGAAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-466s1c1
Sequence:CCGGCGCGACGGTATGACCATCTTTCTCGAGAAAGATGGTCATACCGTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-279s21c1
Sequence:CCGGCGTCTGTGCGGAGAAGTTACTCTCGAGAGTAACTTCTCCGCACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-256s21c1
Sequence:CCGGCATCGAGGACATCCTCAACAACTCGAGTTGTTGAGGATGTCCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006562
LBX1 MISSION shRNA Lentiviral Transduction Particles
ladybird homeobox 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006562.3-1129s1c1
Sequence:CCGGCTCTTCCCTCTCGAAGCAATACTCGAGTATTGCTTCGAGAGGGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-408s1c1
Sequence:CCGGGCTCGCCAGCAAGACGTTTAACTCGAGTTAAACGTCTTGCTGGCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-636s1c1
Sequence:CCGGCGCGCAAGTCATCACCTGGTTCTCGAGAACCAGGTGATGACTTGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-564s1c1
Sequence:CCGGGCGCTTTCTATACCAGAAGTACTCGAGTACTTCTGGTATAGAAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006562.3-466s1c1
Sequence:CCGGCGCGACGGTATGACCATCTTTCTCGAGAAAGATGGTCATACCGTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-279s21c1
Sequence:CCGGCGTCTGTGCGGAGAAGTTACTCTCGAGAGTAACTTCTCCGCACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006562.4-256s21c1
Sequence:CCGGCATCGAGGACATCCTCAACAACTCGAGTTGTTGAGGATGTCCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010691
LBX1 MISSION shRNA Bacterial Glycerol Stock
ladybird homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-424s1c1
Sequence:CCGGGAGTTGGAGAAACGCTTTCTACTCGAGTAGAAAGCGTTTCTCCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-337s1c1
Sequence:CCGGCGCGATGGGATGACCATCTTTCTCGAGAAAGATGGTCATCCCATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-151s1c1
Sequence:CCGGCGGAGAAGTTACTCGCTGTGTCTCGAGACACAGCGAGTAACTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-279s1c1
Sequence:CCGGGCTCGCCAGCAAGACCTTTAACTCGAGTTAAAGGTCTTGCTGGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-498s1c1
Sequence:CCGGCCTCACCAATGCACAGGTCATCTCGAGATGACCTGTGCATTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-369s21c1
Sequence:CCGGGACGCCCAAGAAACGGCGAAACTCGAGTTTCGCCGTTTCTTGGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-578s21c1
Sequence:CCGGACGTGGAGTCTGCCAAGAAACCTCGAGGTTTCTTGGCAGACTCCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-116s21c1
Sequence:CCGGTCAGCATCGAGGACATCCTCACTCGAGTGAGGATGTCCTCGATGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010691
LBX1 MISSION shRNA shRNA Plasmid DNA
ladybird homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-424s1c1
Sequence:CCGGGAGTTGGAGAAACGCTTTCTACTCGAGTAGAAAGCGTTTCTCCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-337s1c1
Sequence:CCGGCGCGATGGGATGACCATCTTTCTCGAGAAAGATGGTCATCCCATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-151s1c1
Sequence:CCGGCGGAGAAGTTACTCGCTGTGTCTCGAGACACAGCGAGTAACTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-279s1c1
Sequence:CCGGGCTCGCCAGCAAGACCTTTAACTCGAGTTAAAGGTCTTGCTGGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-498s1c1
Sequence:CCGGCCTCACCAATGCACAGGTCATCTCGAGATGACCTGTGCATTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-369s21c1
Sequence:CCGGGACGCCCAAGAAACGGCGAAACTCGAGTTTCGCCGTTTCTTGGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-578s21c1
Sequence:CCGGACGTGGAGTCTGCCAAGAAACCTCGAGGTTTCTTGGCAGACTCCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-116s21c1
Sequence:CCGGTCAGCATCGAGGACATCCTCACTCGAGTGAGGATGTCCTCGATGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010691
LBX1 MISSION shRNA Lentiviral Transduction Particles
ladybird homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-424s1c1
Sequence:CCGGGAGTTGGAGAAACGCTTTCTACTCGAGTAGAAAGCGTTTCTCCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-337s1c1
Sequence:CCGGCGCGATGGGATGACCATCTTTCTCGAGAAAGATGGTCATCCCATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-151s1c1
Sequence:CCGGCGGAGAAGTTACTCGCTGTGTCTCGAGACACAGCGAGTAACTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-279s1c1
Sequence:CCGGGCTCGCCAGCAAGACCTTTAACTCGAGTTAAAGGTCTTGCTGGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010691.2-498s1c1
Sequence:CCGGCCTCACCAATGCACAGGTCATCTCGAGATGACCTGTGCATTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-369s21c1
Sequence:CCGGGACGCCCAAGAAACGGCGAAACTCGAGTTTCGCCGTTTCTTGGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-578s21c1
Sequence:CCGGACGTGGAGTCTGCCAAGAAACCTCGAGGTTTCTTGGCAGACTCCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010691.5-116s21c1
Sequence:CCGGTCAGCATCGAGGACATCCTCACTCGAGTGAGGATGTCCTCGATGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)