EMAIL THIS PAGE TO A FRIEND

LBX2

ladybird homeobox 2

36 Gene Product Result for
UniProtKB ID: Q6XYB7, Q7Z5Y8
Gene ID:
Mouse(16815) ladybird homeobox homolog 2 (Drosophila)
Rat(500224) ladybird homeobox 2
Zebrafish(64276) ladybird homeobox homolog 2 (Drosophila)
cow(538906) ladybird homeobox 2
domestic cat(101086966) ladybird homeobox 2
dog(483103) ladybird homeobox 2
domestic guinea pig(100735457) ladybird homeobox 2
naked mole-rat(101697962) ladybird homeobox 2
sheep(101118683) ladybird homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044257 Anti-LBX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009812 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036921 MISSION® esiRNA esiRNA targeting mouse Lbx2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009812 Rosetta Predictions human pricing
NM_001109244 Rosetta Predictions rat pricing
NM_010692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022442 predicted 577
2 SASI_Hs01_00022443 predicted 815
3 SASI_Hs01_00022444 predicted 571
4 SASI_Hs01_00022445 predicted 845
5 SASI_Hs01_00022447 predicted 686
6 SASI_Hs01_00022448 predicted 880
7 SASI_Hs01_00022449 predicted 516
8 SASI_Hs01_00022450 predicted 768
9 SASI_Hs01_00022451 predicted 782
10 SASI_Hs02_00305687 predicted 912
11 SASI_Hs01_00022446 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246504 predicted 219
2 SASI_Rn02_00246505 predicted 504
3 SASI_Rn02_00246506 predicted 561
4 SASI_Rn02_00246507 predicted 407
5 SASI_Rn02_00246508 predicted 309
6 SASI_Rn02_00246509 predicted 348
7 SASI_Rn02_00246510 predicted 371
8 SASI_Rn02_00246511 predicted 426
9 SASI_Rn02_00246512 predicted 387
10 SASI_Rn02_00246513 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178955 predicted 589
2 SASI_Mm01_00178956 predicted 307
3 SASI_Mm01_00178957 predicted 356
4 SASI_Mm01_00178958 predicted 358
5 SASI_Mm01_00178959 predicted 355
6 SASI_Mm01_00178960 predicted 582
7 SASI_Mm01_00178961 predicted 371
8 SASI_Mm01_00178962 predicted 427
9 SASI_Mm01_00178963 predicted 533
10 SASI_Mm01_00178964 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010692
LBX2 MISSION shRNA Bacterial Glycerol Stock
ladybird homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-316s21c1
Sequence:CCGGAGTCTCGGACAGCGTTCACTGCTCGAGCAGTGAACGCTGTCCGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-192s1c1
Sequence:CCGGCTGGAGGAGCTAGCAAGTAAACTCGAGTTTACTTGCTAGCTCCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-237s21c1
Sequence:CCGGGCTACACCACAGCCTTCTGAACTCGAGTTCAGAAGGCTGTGGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-630s21c1
Sequence:CCGGATACAGGTGGACGATTGAAAGCTCGAGCTTTCAATCGTCCACCTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-362s1c1
Sequence:CCGGGCGATTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-86s1c1
Sequence:CCGGACCCTTTAGTATCGCAGACATCTCGAGATGTCTGCGATACTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-608s1c1
Sequence:CCGGGCCCAACTTATCAGATGAGGACTCGAGTCCTCATCTGATAAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-597s1c1
Sequence:CCGGCCCGATTCTGAGCCCAACTTACTCGAGTAAGTTGGGCTCAGAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-536s21c1
Sequence:CCGGAGTCCTGTGTTACCCAGCACTCTCGAGAGTGCTGGGTAACACAGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-429s21c1
Sequence:CCGGGCTAATGCGCAAGTGGTCACTCTCGAGAGTGACCACTTGCGCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010692
LBX2 MISSION shRNA shRNA Plasmid DNA
ladybird homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-316s21c1
Sequence:CCGGAGTCTCGGACAGCGTTCACTGCTCGAGCAGTGAACGCTGTCCGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-192s1c1
Sequence:CCGGCTGGAGGAGCTAGCAAGTAAACTCGAGTTTACTTGCTAGCTCCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-237s21c1
Sequence:CCGGGCTACACCACAGCCTTCTGAACTCGAGTTCAGAAGGCTGTGGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-630s21c1
Sequence:CCGGATACAGGTGGACGATTGAAAGCTCGAGCTTTCAATCGTCCACCTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-362s1c1
Sequence:CCGGGCGATTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-86s1c1
Sequence:CCGGACCCTTTAGTATCGCAGACATCTCGAGATGTCTGCGATACTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-608s1c1
Sequence:CCGGGCCCAACTTATCAGATGAGGACTCGAGTCCTCATCTGATAAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-597s1c1
Sequence:CCGGCCCGATTCTGAGCCCAACTTACTCGAGTAAGTTGGGCTCAGAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-536s21c1
Sequence:CCGGAGTCCTGTGTTACCCAGCACTCTCGAGAGTGCTGGGTAACACAGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-429s21c1
Sequence:CCGGGCTAATGCGCAAGTGGTCACTCTCGAGAGTGACCACTTGCGCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010692
LBX2 MISSION shRNA Lentiviral Transduction Particles
ladybird homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-316s21c1
Sequence:CCGGAGTCTCGGACAGCGTTCACTGCTCGAGCAGTGAACGCTGTCCGAGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-192s1c1
Sequence:CCGGCTGGAGGAGCTAGCAAGTAAACTCGAGTTTACTTGCTAGCTCCTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-237s21c1
Sequence:CCGGGCTACACCACAGCCTTCTGAACTCGAGTTCAGAAGGCTGTGGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-630s21c1
Sequence:CCGGATACAGGTGGACGATTGAAAGCTCGAGCTTTCAATCGTCCACCTGTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-362s1c1
Sequence:CCGGGCGATTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-86s1c1
Sequence:CCGGACCCTTTAGTATCGCAGACATCTCGAGATGTCTGCGATACTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-608s1c1
Sequence:CCGGGCCCAACTTATCAGATGAGGACTCGAGTCCTCATCTGATAAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010692.2-597s1c1
Sequence:CCGGCCCGATTCTGAGCCCAACTTACTCGAGTAAGTTGGGCTCAGAATCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-536s21c1
Sequence:CCGGAGTCCTGTGTTACCCAGCACTCTCGAGAGTGCTGGGTAACACAGGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010692.3-429s21c1
Sequence:CCGGGCTAATGCGCAAGTGGTCACTCTCGAGAGTGACCACTTGCGCATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009812
LBX2 MISSION shRNA Bacterial Glycerol Stock
ladybird homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-751s21c1
Sequence:CCGGGCGCTTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1008s21c1
Sequence:CCGGACCTGTCAGACGAGGAGATACCTCGAGGTATCTCCTCGTCTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009812.1-1159s21c1
Sequence:CCGGACAGTCCAGACGCTCACCTTTCTCGAGAAAGGTGAGCGTCTGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1030s21c1
Sequence:CCGGGGTGGACGATTGAAGACAAAGCTCGAGCTTTGTCTTCAATCGTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-831s21c1
Sequence:CCGGTGGTCACTTGGTTCCAGAACCCTCGAGGGTTCTGGAACCAAGTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009812
LBX2 MISSION shRNA shRNA Plasmid DNA
ladybird homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-751s21c1
Sequence:CCGGGCGCTTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1008s21c1
Sequence:CCGGACCTGTCAGACGAGGAGATACCTCGAGGTATCTCCTCGTCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009812.1-1159s21c1
Sequence:CCGGACAGTCCAGACGCTCACCTTTCTCGAGAAAGGTGAGCGTCTGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1030s21c1
Sequence:CCGGGGTGGACGATTGAAGACAAAGCTCGAGCTTTGTCTTCAATCGTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-831s21c1
Sequence:CCGGTGGTCACTTGGTTCCAGAACCCTCGAGGGTTCTGGAACCAAGTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009812
LBX2 MISSION shRNA Lentiviral Transduction Particles
ladybird homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-751s21c1
Sequence:CCGGGCGCTTCGTCTTCCAGAAGTACTCGAGTACTTCTGGAAGACGAAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1008s21c1
Sequence:CCGGACCTGTCAGACGAGGAGATACCTCGAGGTATCTCCTCGTCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009812.1-1159s21c1
Sequence:CCGGACAGTCCAGACGCTCACCTTTCTCGAGAAAGGTGAGCGTCTGGACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-1030s21c1
Sequence:CCGGGGTGGACGATTGAAGACAAAGCTCGAGCTTTGTCTTCAATCGTCCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009812.1-831s21c1
Sequence:CCGGTGGTCACTTGGTTCCAGAACCCTCGAGGGTTCTGGAACCAAGTGACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)