EMAIL THIS PAGE TO A FRIEND

LCA10

12 Gene Product Result for
Synonyms: LCAP
Species: Human LCA10(643736)
UniProtKB ID: Q71F78
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039768 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039768 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200617 predicted 801
2 SASI_Hs01_00200618 predicted 787
3 SASI_Hs01_00200619 predicted 798
4 SASI_Hs01_00200620 predicted 794
5 SASI_Hs01_00200621 predicted 762
6 SASI_Hs01_00200622 predicted 790
7 SASI_Hs01_00200624 predicted 897
8 SASI_Hs01_00200625 predicted 930
9 SASI_Hs02_00308665 predicted 852
10 SASI_Hs02_00308666 predicted 848
11 SASI_Hs01_00200623 predicted 764
12 SASI_Hs01_00200626 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039768
LCA10 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039768.2-1128s21c1
Sequence:CCGGGTTTGATTCTGTCTAACAATTCTCGAGAATTGTTAGACAGAATCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-814s21c1
Sequence:CCGGATCGAGAAGGAAGGAGCTCCTCTCGAGAGGAGCTCCTTCCTTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-953s21c1
Sequence:CCGGGAGCATGCAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTGCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-864s21c1
Sequence:CCGGATGACCTCACAGGCGAGGAAGCTCGAGCTTCCTCGCCTGTGAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-904s21c1
Sequence:CCGGTAGACACAGTGGACTGGACAACTCGAGTTGTCCAGTCCACTGTGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039768
LCA10 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039768.2-1128s21c1
Sequence:CCGGGTTTGATTCTGTCTAACAATTCTCGAGAATTGTTAGACAGAATCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-814s21c1
Sequence:CCGGATCGAGAAGGAAGGAGCTCCTCTCGAGAGGAGCTCCTTCCTTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-953s21c1
Sequence:CCGGGAGCATGCAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTGCATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-864s21c1
Sequence:CCGGATGACCTCACAGGCGAGGAAGCTCGAGCTTCCTCGCCTGTGAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-904s21c1
Sequence:CCGGTAGACACAGTGGACTGGACAACTCGAGTTGTCCAGTCCACTGTGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039768
LCA10 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039768.2-1128s21c1
Sequence:CCGGGTTTGATTCTGTCTAACAATTCTCGAGAATTGTTAGACAGAATCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-814s21c1
Sequence:CCGGATCGAGAAGGAAGGAGCTCCTCTCGAGAGGAGCTCCTTCCTTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-953s21c1
Sequence:CCGGGAGCATGCAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTGCATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-864s21c1
Sequence:CCGGATGACCTCACAGGCGAGGAAGCTCGAGCTTCCTCGCCTGTGAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039768.2-904s21c1
Sequence:CCGGTAGACACAGTGGACTGGACAACTCGAGTTGTCCAGTCCACTGTGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)