EMAIL THIS PAGE TO A FRIEND

LCA5

Leber congenital amaurosis 5

121 Gene Product Result for
Synonyms: C6orf152
UniProtKB ID: Q86VQ0, E1P542, Q9BWX7
Gene ID:
Human(167691) Summary: This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
Mouse(75782) Leber congenital amaurosis 5 (human)
Rat(300866) Leber congenital amaurosis 5
Zebrafish(100151323) Leber congenital amaurosis 5
domestic cat(101096569) Leber congenital amaurosis 5
cow(537291) Leber congenital amaurosis 5
Horse(100065273) Leber congenital amaurosis 5
dog(481893) Leber congenital amaurosis 5
chicken(421852) Leber congenital amaurosis 5
sheep(101113154) Leber congenital amaurosis 5
Domestic Rabbit(100353175) Leber congenital amaurosis 5
domestic guinea pig(100723308) Leber congenital amaurosis 5
naked mole-rat(101700623) Leber congenital amaurosis 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122769 Rosetta Predictions human pricing
NM_181714 Rosetta Predictions human pricing
NM_001013954 Rosetta Predictions rat pricing
NM_027448 Rosetta Predictions mouse pricing
NM_029434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327315 predicted 1112
2 SASI_Hs02_00327316 predicted 713
3 SASI_Hs02_00327317 predicted 485
4 SASI_Hs02_00327318 predicted 2518
5 SASI_Hs02_00327319 predicted 1104
6 SASI_Hs02_00327320 predicted 1270
7 SASI_Hs02_00327321 predicted 1756
8 SASI_Hs02_00327322 predicted 1748
9 SASI_Hs02_00327323 predicted 632
10 SASI_Hs02_00327324 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096964 predicted 1287
2 SASI_Hs01_00096965 predicted 890
3 SASI_Hs02_00370323 predicted 664
4 SASI_Hs01_00096966 predicted 2697
5 SASI_Hs01_00096967 predicted 1278
6 SASI_Hs01_00096969 predicted 1444
7 SASI_Hs01_00096970 predicted 1930
8 SASI_Hs01_00096971 predicted 1925
9 SASI_Hs01_00096973 predicted 803
10 SASI_Hs02_00370324 predicted 1081
11 SASI_Hs01_00096968 predicted 666
12 SASI_Hs01_00096972 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201274 predicted 1891
2 SASI_Rn02_00201275 predicted 1908
3 SASI_Rn02_00201276 predicted 814
4 SASI_Rn01_00090047 predicted 652
5 SASI_Rn01_00090048 predicted 831
6 SASI_Rn01_00090049 predicted 1448
7 SASI_Rn01_00090050 predicted 1519
8 SASI_Rn01_00090051 predicted 1676
9 SASI_Rn01_00090052 predicted 843
10 SASI_Rn01_00090053 predicted 939
11 SASI_Rn01_00090054 predicted 360
12 SASI_Rn01_00090055 predicted 1540
13 SASI_Rn01_00090056 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067726 predicted 1198
2 SASI_Mm01_00067727 predicted 1088
3 SASI_Mm01_00067728 predicted 870
4 SASI_Mm01_00067729 predicted 336
5 SASI_Mm01_00067730 predicted 1157
6 SASI_Mm01_00067731 predicted 361
7 SASI_Mm01_00067732 predicted 863
8 SASI_Mm01_00067733 predicted 1039
9 SASI_Mm01_00067734 predicted 966
10 SASI_Mm01_00067735 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195035 predicted 1143
2 SASI_Mm01_00195036 predicted 1023
3 SASI_Mm01_00195037 predicted 810
4 SASI_Mm01_00195038 predicted 280
5 SASI_Mm01_00195039 predicted 1099
6 SASI_Mm01_00195040 predicted 302
7 SASI_Mm01_00195041 predicted 804
8 SASI_Mm01_00195042 predicted 985
9 SASI_Mm01_00195043 predicted 908
10 SASI_Mm01_00195044 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181714
LCA5 MISSION shRNA Bacterial Glycerol Stock
Leber congenital amaurosis 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1936s21c1
Sequence:CCGGCAACTAGGAATGTATCCAATTCTCGAGAATTGGATACATTCCTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1750s21c1
Sequence:CCGGGGGATTCTAAACCCAATTATGCTCGAGCATAATTGGGTTTAGAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-2506s21c1
Sequence:CCGGGGAGACATTGACCCTCTAAATCTCGAGATTTAGAGGGTCAATGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-655s1c1
Sequence:CCGGGAGGCAGGCAAACACCATTATCTCGAGATAATGGTGTTTGCCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1118s1c1
Sequence:CCGGCAGCACTCAAAGAACGCTTAACTCGAGTTAAGCGTTCTTTGAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-889s1c1
Sequence:CCGGCTTCGGAAAGATACTGATCTTCTCGAGAAGATCAGTATCTTTCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1444s1c1
Sequence:CCGGGTACAGCGACTATATCACAAACTCGAGTTTGTGATATAGTCGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-2039s1c1
Sequence:CCGGGAGAACTCCAAGATTCTCGAACTCGAGTTCGAGAATCTTGGAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181714.1-1259s1c1
Sequence:CCGGCTGAACGAGATGATTTGGCAACTCGAGTTGCCAAATCATCTCGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181714
LCA5 MISSION shRNA shRNA Plasmid DNA
Leber congenital amaurosis 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1936s21c1
Sequence:CCGGCAACTAGGAATGTATCCAATTCTCGAGAATTGGATACATTCCTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1750s21c1
Sequence:CCGGGGGATTCTAAACCCAATTATGCTCGAGCATAATTGGGTTTAGAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-2506s21c1
Sequence:CCGGGGAGACATTGACCCTCTAAATCTCGAGATTTAGAGGGTCAATGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-655s1c1
Sequence:CCGGGAGGCAGGCAAACACCATTATCTCGAGATAATGGTGTTTGCCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1118s1c1
Sequence:CCGGCAGCACTCAAAGAACGCTTAACTCGAGTTAAGCGTTCTTTGAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-889s1c1
Sequence:CCGGCTTCGGAAAGATACTGATCTTCTCGAGAAGATCAGTATCTTTCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1444s1c1
Sequence:CCGGGTACAGCGACTATATCACAAACTCGAGTTTGTGATATAGTCGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-2039s1c1
Sequence:CCGGGAGAACTCCAAGATTCTCGAACTCGAGTTCGAGAATCTTGGAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181714.1-1259s1c1
Sequence:CCGGCTGAACGAGATGATTTGGCAACTCGAGTTGCCAAATCATCTCGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181714
LCA5 MISSION shRNA Lentiviral Transduction Particles
Leber congenital amaurosis 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1936s21c1
Sequence:CCGGCAACTAGGAATGTATCCAATTCTCGAGAATTGGATACATTCCTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-1750s21c1
Sequence:CCGGGGGATTCTAAACCCAATTATGCTCGAGCATAATTGGGTTTAGAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181714.3-2506s21c1
Sequence:CCGGGGAGACATTGACCCTCTAAATCTCGAGATTTAGAGGGTCAATGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-655s1c1
Sequence:CCGGGAGGCAGGCAAACACCATTATCTCGAGATAATGGTGTTTGCCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1118s1c1
Sequence:CCGGCAGCACTCAAAGAACGCTTAACTCGAGTTAAGCGTTCTTTGAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-889s1c1
Sequence:CCGGCTTCGGAAAGATACTGATCTTCTCGAGAAGATCAGTATCTTTCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-1444s1c1
Sequence:CCGGGTACAGCGACTATATCACAAACTCGAGTTTGTGATATAGTCGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181714.1-2039s1c1
Sequence:CCGGGAGAACTCCAAGATTCTCGAACTCGAGTTCGAGAATCTTGGAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181714.1-1259s1c1
Sequence:CCGGCTGAACGAGATGATTTGGCAACTCGAGTTGCCAAATCATCTCGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027448
LCA5 MISSION shRNA Bacterial Glycerol Stock
Leber congenital amaurosis 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2627s21c1
Sequence:CCGGCAAATAGTGCCGTACCATAAACTCGAGTTTATGGTACGGCACTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2605s21c1
Sequence:CCAGGGCTAAATATGGCACAATTAACTCGAGTTAATTGTGCCATATTTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027448.1-3235s1c1
Sequence:CCGGCCGGAGTGATATGTTTGGAAACTCGAGTTTCCAAACATATCACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-489s1c1
Sequence:CCGGCCGTTAGGAAAGTAAGTCCTACTCGAGTAGGACTTACTTTCCTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-1661s1c1
Sequence:CCGGGCAGAAAGACTAAAGACAGAACTCGAGTTCTGTCTTTAGTCTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-771s1c1
Sequence:CCGGCACAACTTATACACCGCCATACTCGAGTATGGCGGTGTATAAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-2063s1c1
Sequence:CCGGCCGAGTAAAGACAGTCTTGATCTCGAGATCAAGACTGTCTTTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027448
LCA5 MISSION shRNA shRNA Plasmid DNA
Leber congenital amaurosis 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2627s21c1
Sequence:CCGGCAAATAGTGCCGTACCATAAACTCGAGTTTATGGTACGGCACTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2605s21c1
Sequence:CCAGGGCTAAATATGGCACAATTAACTCGAGTTAATTGTGCCATATTTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027448.1-3235s1c1
Sequence:CCGGCCGGAGTGATATGTTTGGAAACTCGAGTTTCCAAACATATCACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-489s1c1
Sequence:CCGGCCGTTAGGAAAGTAAGTCCTACTCGAGTAGGACTTACTTTCCTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-1661s1c1
Sequence:CCGGGCAGAAAGACTAAAGACAGAACTCGAGTTCTGTCTTTAGTCTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-771s1c1
Sequence:CCGGCACAACTTATACACCGCCATACTCGAGTATGGCGGTGTATAAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-2063s1c1
Sequence:CCGGCCGAGTAAAGACAGTCTTGATCTCGAGATCAAGACTGTCTTTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027448
LCA5 MISSION shRNA Lentiviral Transduction Particles
Leber congenital amaurosis 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2627s21c1
Sequence:CCGGCAAATAGTGCCGTACCATAAACTCGAGTTTATGGTACGGCACTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027448.2-2605s21c1
Sequence:CCAGGGCTAAATATGGCACAATTAACTCGAGTTAATTGTGCCATATTTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027448.1-3235s1c1
Sequence:CCGGCCGGAGTGATATGTTTGGAAACTCGAGTTTCCAAACATATCACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-489s1c1
Sequence:CCGGCCGTTAGGAAAGTAAGTCCTACTCGAGTAGGACTTACTTTCCTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-1661s1c1
Sequence:CCGGGCAGAAAGACTAAAGACAGAACTCGAGTTCTGTCTTTAGTCTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-771s1c1
Sequence:CCGGCACAACTTATACACCGCCATACTCGAGTATGGCGGTGTATAAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027448.1-2063s1c1
Sequence:CCGGCCGAGTAAAGACAGTCTTGATCTCGAGATCAAGACTGTCTTTACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)