EMAIL THIS PAGE TO A FRIEND

LCA5L

Leber congenital amaurosis 5-like

50 Gene Product Result for
Synonyms: C21orf13
UniProtKB ID: O95447, D3DSI0, Q3ZCT0
Gene ID:
Mouse(385668) Leber congenital amaurosis 5-like
Rat(498065) Leber congenital amaurosis 5-like
domestic guinea pig(100712894) Leber congenital amaurosis 5-like
naked mole-rat(101712819) Leber congenital amaurosis 5-like
sheep(101123084) Leber congenital amaurosis 5-like
Domestic Rabbit(100355670) Leber congenital amaurosis 5-like
chicken(418522) Leber congenital amaurosis 5-like
domestic cat(101098480) Leber congenital amaurosis 5-like
dog(478416) Leber congenital amaurosis 5-like
cow(781766) Leber congenital amaurosis 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066821 MISSION® esiRNA esiRNA human C21orf13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152505 Rosetta Predictions human pricing
NM_001017484 Rosetta Predictions rat pricing
NM_001001492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054403 predicted 1007
2 SASI_Hs01_00054404 predicted 965
3 SASI_Hs01_00054405 predicted 1943
4 SASI_Hs01_00054407 predicted 1081
5 SASI_Hs01_00054410 predicted 1317
6 SASI_Hs01_00054411 predicted 1996
7 SASI_Hs02_00366287 predicted 1976
8 SASI_Hs02_00366288 predicted 1197
9 SASI_Hs02_00366289 predicted 1079
10 SASI_Hs02_00366290 predicted 699
11 SASI_Hs01_00054402 predicted 1081
12 SASI_Hs01_00054406 predicted 1223
13 SASI_Hs01_00054408 predicted 337
14 SASI_Hs01_00054409 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079905 predicted 1317
2 SASI_Rn01_00079906 predicted 577
3 SASI_Rn01_00079907 predicted 1391
4 SASI_Rn01_00079908 predicted 692
5 SASI_Rn01_00079909 predicted 1462
6 SASI_Rn01_00079910 predicted 810
7 SASI_Rn01_00079911 predicted 668
8 SASI_Rn01_00079912 predicted 1152
9 SASI_Rn01_00079913 predicted 1018
10 SASI_Rn01_00079914 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191413 predicted 677
2 SASI_Mm01_00191414 predicted 1213
3 SASI_Mm01_00191415 predicted 375
4 SASI_Mm01_00191416 predicted 866
5 SASI_Mm01_00191417 predicted 852
6 SASI_Mm01_00191418 predicted 568
7 SASI_Mm01_00191420 predicted 1165
8 SASI_Mm01_00191421 predicted 1377
9 SASI_Mm01_00191422 predicted 1408
10 SASI_Mm02_00286174 predicted 1700
11 SASI_Mm01_00191419 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152505
LCA5L MISSION shRNA Bacterial Glycerol Stock
Leber congenital amaurosis 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-481s1c1
Sequence:CCGGGCTCCTGTGGAAGTTTAAGTTCTCGAGAACTTAAACTTCCACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1453s1c1
Sequence:CCGGCAGATGTTCCACCTTTGACAACTCGAGTTGTCAAAGGTGGAACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-2016s1c1
Sequence:CCGGGAGCATTCTGACAGTGGGTATCTCGAGATACCCACTGTCAGAATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-444s1c1
Sequence:CCGGGCTTCCAATAAGAGTGTTGATCTCGAGATCAACACTCTTATTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1049s1c1
Sequence:CCGGGCAGAAACTTTCTGAAGACAACTCGAGTTGTCTTCAGAAAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1698s1c1
Sequence:CCGGGTGAAAGAAGAGCAAGAACTACTCGAGTAGTTCTTGCTCTTCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1464s1c1
Sequence:CCGGCCTTTGACAACTAAGGGTAAACTCGAGTTTACCCTTAGTTGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1865s1c1
Sequence:CCGGCCTCAGACAAAGAAGACATTACTCGAGTAATGTCTTCTTTGTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-851s1c1
Sequence:CCGGGCTTAGGCATTTGAAAGCTATCTCGAGATAGCTTTCAAATGCCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152505
LCA5L MISSION shRNA shRNA Plasmid DNA
Leber congenital amaurosis 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-481s1c1
Sequence:CCGGGCTCCTGTGGAAGTTTAAGTTCTCGAGAACTTAAACTTCCACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1453s1c1
Sequence:CCGGCAGATGTTCCACCTTTGACAACTCGAGTTGTCAAAGGTGGAACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-2016s1c1
Sequence:CCGGGAGCATTCTGACAGTGGGTATCTCGAGATACCCACTGTCAGAATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-444s1c1
Sequence:CCGGGCTTCCAATAAGAGTGTTGATCTCGAGATCAACACTCTTATTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1049s1c1
Sequence:CCGGGCAGAAACTTTCTGAAGACAACTCGAGTTGTCTTCAGAAAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1698s1c1
Sequence:CCGGGTGAAAGAAGAGCAAGAACTACTCGAGTAGTTCTTGCTCTTCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1464s1c1
Sequence:CCGGCCTTTGACAACTAAGGGTAAACTCGAGTTTACCCTTAGTTGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1865s1c1
Sequence:CCGGCCTCAGACAAAGAAGACATTACTCGAGTAATGTCTTCTTTGTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-851s1c1
Sequence:CCGGGCTTAGGCATTTGAAAGCTATCTCGAGATAGCTTTCAAATGCCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152505
LCA5L MISSION shRNA Lentiviral Transduction Particles
Leber congenital amaurosis 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-481s1c1
Sequence:CCGGGCTCCTGTGGAAGTTTAAGTTCTCGAGAACTTAAACTTCCACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1453s1c1
Sequence:CCGGCAGATGTTCCACCTTTGACAACTCGAGTTGTCAAAGGTGGAACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-2016s1c1
Sequence:CCGGGAGCATTCTGACAGTGGGTATCTCGAGATACCCACTGTCAGAATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-444s1c1
Sequence:CCGGGCTTCCAATAAGAGTGTTGATCTCGAGATCAACACTCTTATTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1049s1c1
Sequence:CCGGGCAGAAACTTTCTGAAGACAACTCGAGTTGTCTTCAGAAAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152505.2-1698s1c1
Sequence:CCGGGTGAAAGAAGAGCAAGAACTACTCGAGTAGTTCTTGCTCTTCTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1464s1c1
Sequence:CCGGCCTTTGACAACTAAGGGTAAACTCGAGTTTACCCTTAGTTGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-1865s1c1
Sequence:CCGGCCTCAGACAAAGAAGACATTACTCGAGTAATGTCTTCTTTGTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152505.2-851s1c1
Sequence:CCGGGCTTAGGCATTTGAAAGCTATCTCGAGATAGCTTTCAAATGCCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001492
LCA5L MISSION shRNA Bacterial Glycerol Stock
Leber congenital amaurosis 5-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001492.1-2802s1c1
Sequence:CCGGGCGCATAAATTCTGCCAGCAACTCGAGTTGCTGGCAGAATTTATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.1-488s1c1
Sequence:CCGGGCCTGACTTCTCACTATGACTCTCGAGAGTCATAGTGAGAAGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1319s21c1
Sequence:CCGGACATCTATACGAATCGAATACCTCGAGGTATTCGATTCGTATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1596s21c1
Sequence:CCGGAGCCAATCTCACGGTCTTAAACTCGAGTTTAAGACCGTGAGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.2-1370s1c1
Sequence:CCGGCGAAAGTTTCTTCAACGAAATCTCGAGATTTCGTTGAAGAAACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-944s21c1
Sequence:CCGGTTCGACAGCTCCTCCGGAAATCTCGAGATTTCCGGAGGAGCTGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1697s21c1
Sequence:CCGGGTACCCATACAGCAGATTTATCTCGAGATAAATCTGCTGTATGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001492.2-2607s21c1
Sequence:CCGGTGGGTGGACTGTGGGTAATTTCTCGAGAAATTACCCACAGTCCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001492
LCA5L MISSION shRNA shRNA Plasmid DNA
Leber congenital amaurosis 5-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001492.1-2802s1c1
Sequence:CCGGGCGCATAAATTCTGCCAGCAACTCGAGTTGCTGGCAGAATTTATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.1-488s1c1
Sequence:CCGGGCCTGACTTCTCACTATGACTCTCGAGAGTCATAGTGAGAAGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1319s21c1
Sequence:CCGGACATCTATACGAATCGAATACCTCGAGGTATTCGATTCGTATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1596s21c1
Sequence:CCGGAGCCAATCTCACGGTCTTAAACTCGAGTTTAAGACCGTGAGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.2-1370s1c1
Sequence:CCGGCGAAAGTTTCTTCAACGAAATCTCGAGATTTCGTTGAAGAAACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-944s21c1
Sequence:CCGGTTCGACAGCTCCTCCGGAAATCTCGAGATTTCCGGAGGAGCTGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1697s21c1
Sequence:CCGGGTACCCATACAGCAGATTTATCTCGAGATAAATCTGCTGTATGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001492.2-2607s21c1
Sequence:CCGGTGGGTGGACTGTGGGTAATTTCTCGAGAAATTACCCACAGTCCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001492
LCA5L MISSION shRNA Lentiviral Transduction Particles
Leber congenital amaurosis 5-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001492.1-2802s1c1
Sequence:CCGGGCGCATAAATTCTGCCAGCAACTCGAGTTGCTGGCAGAATTTATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.1-488s1c1
Sequence:CCGGGCCTGACTTCTCACTATGACTCTCGAGAGTCATAGTGAGAAGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1319s21c1
Sequence:CCGGACATCTATACGAATCGAATACCTCGAGGTATTCGATTCGTATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1596s21c1
Sequence:CCGGAGCCAATCTCACGGTCTTAAACTCGAGTTTAAGACCGTGAGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001492.2-1370s1c1
Sequence:CCGGCGAAAGTTTCTTCAACGAAATCTCGAGATTTCGTTGAAGAAACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-944s21c1
Sequence:CCGGTTCGACAGCTCCTCCGGAAATCTCGAGATTTCCGGAGGAGCTGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001492.2-1697s21c1
Sequence:CCGGGTACCCATACAGCAGATTTATCTCGAGATAAATCTGCTGTATGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001492.2-2607s21c1
Sequence:CCGGTGGGTGGACTGTGGGTAATTTCTCGAGAAATTACCCACAGTCCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)