EMAIL THIS PAGE TO A FRIEND

LCAT

lecithin-cholesterol acyltransferase

58 Gene Product Result for
UniProtKB ID: P04180, Q53XQ3
Gene ID:
Human(3931) Summary: This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
Mouse(16816) lecithin cholesterol acyltransferase
Rat(24530) lecithin cholesterol acyltransferase
Zebrafish(114449) lecithin-cholesterol acyltransferase
cow(510960) lecithin-cholesterol acyltransferase
Horse(100053753) lecithin-cholesterol acyltransferase
domestic cat(101083225) lecithin-cholesterol acyltransferase
dog(479680) lecithin-cholesterol acyltransferase
chicken(396136) lecithin-cholesterol acyltransferase
sheep(100302343) lecithin-cholesterol acyltransferase
Domestic Rabbit(100008978) lecithin-cholesterol acyltransferase
domestic guinea pig(100727686) lecithin-cholesterol acyltransferase
naked mole-rat(101700977) lecithin-cholesterol acyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK107 LCAT Activity Assay Kit Supplied by Roar Biomedical, Inc. human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000229 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000229 Rosetta Predictions human pricing
NM_017024 Rosetta Predictions rat pricing
NM_008490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213838 predicted 293
2 SASI_Hs01_00213840 predicted 622
3 SASI_Hs01_00213841 predicted 795
4 SASI_Hs02_00302133 predicted 449
5 SASI_Hs01_00213842 predicted 1000
6 SASI_Hs01_00213843 predicted 422
7 SASI_Hs01_00213844 predicted 1017
8 SASI_Hs01_00213845 predicted 213
9 SASI_Hs01_00213846 predicted 973
10 SASI_Hs01_00213847 predicted 785
11 SASI_Hs01_00213839 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261196 predicted 577
2 SASI_Rn01_00056653 predicted 261
3 SASI_Rn01_00056654 predicted 786
4 SASI_Rn01_00056656 predicted 1059
5 SASI_Rn01_00056657 predicted 660
6 SASI_Rn01_00056659 predicted 229
7 SASI_Rn02_00261197 predicted 424
8 SASI_Rn02_00261198 predicted 857
9 SASI_Rn01_00056661 predicted 1014
10 SASI_Rn01_00056662 predicted 387
11 SASI_Rn01_00056655 predicted 444
12 SASI_Rn01_00056658 predicted 273
13 SASI_Rn01_00056660 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034396 predicted 627
2 SASI_Mm01_00034397 predicted 891
3 SASI_Mm01_00034398 predicted 859
4 SASI_Mm01_00034399 predicted 656
5 SASI_Mm01_00034401 predicted 419
6 SASI_Mm01_00034402 predicted 255
7 SASI_Mm01_00034403 predicted 788
8 SASI_Mm01_00034404 predicted 218
9 SASI_Mm02_00314027 predicted 292
10 SASI_Mm01_00034405 predicted 847
11 SASI_Mm01_00034400 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008490
LCAT MISSION shRNA Bacterial Glycerol Stock
lecithin-cholesterol acyltransferase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-456s21c1
Sequence:CCGGATCTGGTTAACAACGGATATGCTCGAGCATATCCGTTGTTAACCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-792s21c1
Sequence:CCGGTGAAAGAGGAGCAGCGCATAACTCGAGTTATGCGCTGCTCCTCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-993s21c1
Sequence:CCGGCACCTGGTGTAGAAGTATATTCTCGAGAATATACTTCTACACCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-183s21c1
Sequence:CCGGTAGAAGCCAAGCTGGATAAACCTCGAGGTTTATCCAGCTTGGCTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-532s1c1
Sequence:CCGGGCAGGATGAATACTACAAGAACTCGAGTTCTTGTAGTATTCATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-529s1c1
Sequence:CCGGCCAGCAGGATGAATACTACAACTCGAGTTGTAGTATTCATCCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008490
LCAT MISSION shRNA shRNA Plasmid DNA
lecithin-cholesterol acyltransferase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-456s21c1
Sequence:CCGGATCTGGTTAACAACGGATATGCTCGAGCATATCCGTTGTTAACCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-792s21c1
Sequence:CCGGTGAAAGAGGAGCAGCGCATAACTCGAGTTATGCGCTGCTCCTCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-993s21c1
Sequence:CCGGCACCTGGTGTAGAAGTATATTCTCGAGAATATACTTCTACACCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-183s21c1
Sequence:CCGGTAGAAGCCAAGCTGGATAAACCTCGAGGTTTATCCAGCTTGGCTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-532s1c1
Sequence:CCGGGCAGGATGAATACTACAAGAACTCGAGTTCTTGTAGTATTCATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-529s1c1
Sequence:CCGGCCAGCAGGATGAATACTACAACTCGAGTTGTAGTATTCATCCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008490
LCAT MISSION shRNA Lentiviral Transduction Particles
lecithin-cholesterol acyltransferase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-456s21c1
Sequence:CCGGATCTGGTTAACAACGGATATGCTCGAGCATATCCGTTGTTAACCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-792s21c1
Sequence:CCGGTGAAAGAGGAGCAGCGCATAACTCGAGTTATGCGCTGCTCCTCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-993s21c1
Sequence:CCGGCACCTGGTGTAGAAGTATATTCTCGAGAATATACTTCTACACCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008490.1-183s21c1
Sequence:CCGGTAGAAGCCAAGCTGGATAAACCTCGAGGTTTATCCAGCTTGGCTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-532s1c1
Sequence:CCGGGCAGGATGAATACTACAAGAACTCGAGTTCTTGTAGTATTCATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008490.1-529s1c1
Sequence:CCGGCCAGCAGGATGAATACTACAACTCGAGTTGTAGTATTCATCCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000229
LCAT MISSION shRNA Bacterial Glycerol Stock
lecithin-cholesterol acyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-909s1c1
Sequence:CCGGCGTGACTTCCAACGCTTCTTTCTCGAGAAAGAAGCGTTGGAAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-456s1c1
Sequence:CCGGGTGCAGAACCTGGTCAACAATCTCGAGATTGTTGACCAGGTTCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-1098s1c1
Sequence:CCGGGTGCTCTATGAGGATGGTGATCTCGAGATCACCATCCTCATAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-683s1c1
Sequence:CCGGCCGCTTTATTGATGGCTTCATCTCGAGATGAAGCCATCAATAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-311s1c1
Sequence:CCGGCGATAACACCAGGGTTGTCTACTCGAGTAGACAACCCTGGTGTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000229
LCAT MISSION shRNA shRNA Plasmid DNA
lecithin-cholesterol acyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-909s1c1
Sequence:CCGGCGTGACTTCCAACGCTTCTTTCTCGAGAAAGAAGCGTTGGAAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-456s1c1
Sequence:CCGGGTGCAGAACCTGGTCAACAATCTCGAGATTGTTGACCAGGTTCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-1098s1c1
Sequence:CCGGGTGCTCTATGAGGATGGTGATCTCGAGATCACCATCCTCATAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-683s1c1
Sequence:CCGGCCGCTTTATTGATGGCTTCATCTCGAGATGAAGCCATCAATAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-311s1c1
Sequence:CCGGCGATAACACCAGGGTTGTCTACTCGAGTAGACAACCCTGGTGTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000229
LCAT MISSION shRNA Lentiviral Transduction Particles
lecithin-cholesterol acyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-909s1c1
Sequence:CCGGCGTGACTTCCAACGCTTCTTTCTCGAGAAAGAAGCGTTGGAAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-456s1c1
Sequence:CCGGGTGCAGAACCTGGTCAACAATCTCGAGATTGTTGACCAGGTTCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-1098s1c1
Sequence:CCGGGTGCTCTATGAGGATGGTGATCTCGAGATCACCATCCTCATAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-683s1c1
Sequence:CCGGCCGCTTTATTGATGGCTTCATCTCGAGATGAAGCCATCAATAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000229.1-311s1c1
Sequence:CCGGCGATAACACCAGGGTTGTCTACTCGAGTAGACAACCCTGGTGTTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)