EMAIL THIS PAGE TO A FRIEND

Lce1a2

12 Gene Product Result for
Species: Mouse Lce1a2(73722)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU207841 MISSION® esiRNA targeting mouse Lce1a2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_028625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041425 predicted 672
2 SASI_Mm01_00041426 predicted 662
3 SASI_Mm01_00041427 predicted 661
4 SASI_Mm01_00041428 predicted 532
5 SASI_Mm01_00041429 predicted 663
6 SASI_Mm01_00041430 predicted 537
7 SASI_Mm01_00041431 predicted 627
8 SASI_Mm01_00041432 predicted 532
9 SASI_Mm01_00041433 predicted 601
10 SASI_Mm02_00334140 predicted 603
11 SASI_Mm01_00041424 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028625
Lce1a2 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028625.2-535s21c1
Sequence:CCGGTAACACTTTAGACTTCCATTCCTCGAGGAATGGAAGTCTAAAGTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-164s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAGTGCTCGAGCACTTGGGAGGACACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-524s21c1
Sequence:CCGGACCTGAGCAACTAACACTTTACTCGAGTAAAGTGTTAGTTGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-368s21c1
Sequence:CCGGATGTTGTAGCAGTGGTGGCAGCTCGAGCTGCCACCACTGCTACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-354s21c1
Sequence:CCGGCGCCATAGCTCTGGATGTTGTCTCGAGACAACATCCAGAGCTATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028625
Lce1a2 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028625.2-535s21c1
Sequence:CCGGTAACACTTTAGACTTCCATTCCTCGAGGAATGGAAGTCTAAAGTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-164s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAGTGCTCGAGCACTTGGGAGGACACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-524s21c1
Sequence:CCGGACCTGAGCAACTAACACTTTACTCGAGTAAAGTGTTAGTTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-368s21c1
Sequence:CCGGATGTTGTAGCAGTGGTGGCAGCTCGAGCTGCCACCACTGCTACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-354s21c1
Sequence:CCGGCGCCATAGCTCTGGATGTTGTCTCGAGACAACATCCAGAGCTATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028625
Lce1a2 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028625.2-535s21c1
Sequence:CCGGTAACACTTTAGACTTCCATTCCTCGAGGAATGGAAGTCTAAAGTGTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-164s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAGTGCTCGAGCACTTGGGAGGACACTTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-524s21c1
Sequence:CCGGACCTGAGCAACTAACACTTTACTCGAGTAAAGTGTTAGTTGCTCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-368s21c1
Sequence:CCGGATGTTGTAGCAGTGGTGGCAGCTCGAGCTGCCACCACTGCTACAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028625.2-354s21c1
Sequence:CCGGCGCCATAGCTCTGGATGTTGTCTCGAGACAACATCCAGAGCTATGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???