EMAIL THIS PAGE TO A FRIEND

LCE1A

late cornified envelope 1A

3 Gene Product Result for
Synonyms: LEP1
Species: Human LCE1A(353131)
UniProtKB ID: Q5T7P2
Gene ID:
Human(353131) Summary: LCE1A belongs to the late cornified envelope (LCE) gene cluster within the epidermal differentiation complex (EDC) on chromosome 1. The LCE cluster contains multiple conserved genes that encode stratum corneum proteins, and these genes are expressed relatively late during fetal assembly of the skin cornified envelope (Jackson et al., 2005 [PubMed 15854049]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301321 ANTI-LCE1A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178348
LCE1A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-132s21c1
Sequence:CCGGCAGTGTCAGCTCCGGAGGCTGCTCGAGCAGCCTCCGGAGCTGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-148s21c1
Sequence:CCGGGGCTGCTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAGCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCAGTCTCTTCTCGAGAAGAGACTGGAGGGCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-117s21c1
Sequence:CCGGAGTCTCTTCCTGCTGCAGTGTCTCGAGACACTGCAGCAGGAAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-52s21c1
Sequence:CCGGCCCAAGTGCCCTCCCAAGTGCCTCGAGGCACTTGGGAGGGCACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178348
LCE1A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-132s21c1
Sequence:CCGGCAGTGTCAGCTCCGGAGGCTGCTCGAGCAGCCTCCGGAGCTGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-148s21c1
Sequence:CCGGGGCTGCTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAGCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCAGTCTCTTCTCGAGAAGAGACTGGAGGGCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-117s21c1
Sequence:CCGGAGTCTCTTCCTGCTGCAGTGTCTCGAGACACTGCAGCAGGAAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-52s21c1
Sequence:CCGGCCCAAGTGCCCTCCCAAGTGCCTCGAGGCACTTGGGAGGGCACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178348
LCE1A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-132s21c1
Sequence:CCGGCAGTGTCAGCTCCGGAGGCTGCTCGAGCAGCCTCCGGAGCTGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-148s21c1
Sequence:CCGGGGCTGCTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAGCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCAGTCTCTTCTCGAGAAGAGACTGGAGGGCACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-117s21c1
Sequence:CCGGAGTCTCTTCCTGCTGCAGTGTCTCGAGACACTGCAGCAGGAAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178348.1-52s21c1
Sequence:CCGGCCCAAGTGCCCTCCCAAGTGCCTCGAGGCACTTGGGAGGGCACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)