EMAIL THIS PAGE TO A FRIEND

LCE1B

late cornified envelope 1B

38 Gene Product Result for
Synonyms: LEP2 SPRL2A
UniProtKB ID: Q5T7P3, A4IF40
Gene ID:
Mouse(68720) late cornified envelope 1B
Rat(685972) late cornified envelope 1B
naked mole-rat(101726410) late cornified envelope 1B
cow(786307) late cornified envelope 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU212331 MISSION® esiRNA esiRNA targeting mouse Lce1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178349 Rosetta Predictions human pricing
XM_001066001 Rosetta Predictions rat pricing
NM_026822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038283 predicted 898
2 SASI_Hs01_00038284 predicted 821
3 SASI_Hs01_00038285 predicted 863
4 SASI_Hs01_00038286 predicted 860
5 SASI_Hs01_00038287 predicted 846
6 SASI_Hs01_00038288 predicted 899
7 SASI_Hs01_00038289 predicted 835
8 SASI_Hs01_00038290 predicted 899
9 SASI_Hs01_00038291 predicted 831
10 SASI_Hs01_00038292 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316035 predicted 59
2 SASI_Rn02_00316036 predicted 65
3 SASI_Rn02_00316037 predicted 43
4 SASI_Rn02_00316038 predicted 56
5 SASI_Rn02_00316039 predicted 22
6 SASI_Rn02_00316040 predicted 49
7 SASI_Rn02_00316041 predicted 54
8 SASI_Rn02_00316042 predicted 44
9 SASI_Rn02_00316043 predicted 38
10 SASI_Rn02_00316044 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043481 predicted 570
2 SASI_Mm01_00043482 predicted 558
3 SASI_Mm01_00043483 predicted 563
4 SASI_Mm01_00043484 predicted 496
5 SASI_Mm01_00043485 predicted 521
6 SASI_Mm01_00043487 predicted 521
7 SASI_Mm01_00043488 predicted 499
8 SASI_Mm01_00043489 predicted 546
9 SASI_Mm01_00043490 predicted 470
10 SASI_Mm01_00043486 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178349
LCE1B MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-947s1c1
Sequence:CCGGCATAGAGGATTCTTCTGTCTTCTCGAGAAGACAGAAGAATCCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-1024s21c1
Sequence:CCGGTTGCGTATGTGTGGTTGCTCTCTCGAGAGAGCAACCACACATACGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-867s21c1
Sequence:CCGGCAAATATTTCCCTTCCGTCTTCTCGAGAAGACGGAAGGGAAATATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-907s21c1
Sequence:CCGGCCCATGTTGTTGAGAGGTCTTCTCGAGAAGACCTCTCAACAACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-936s1c1
Sequence:CCGGCTCAACTCAAGCATAGAGGATCTCGAGATCCTCTATGCTTGAGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1001s1c1
Sequence:CCGGCCAAGCCATTTAATGACCTCACTCGAGTGAGGTCATTAAATGGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-851s1c1
Sequence:CCGGGAAGAACACAAATGGCCAAATCTCGAGATTTGGCCATTTGTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1005s1c1
Sequence:CCGGGCCATTTAATGACCTCAGTTTCTCGAGAAACTGAGGTCATTAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-946s1c1
Sequence:CCGGGCATAGAGGATTCTTCTGTCTCTCGAGAGACAGAAGAATCCTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178349
LCE1B MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-947s1c1
Sequence:CCGGCATAGAGGATTCTTCTGTCTTCTCGAGAAGACAGAAGAATCCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-1024s21c1
Sequence:CCGGTTGCGTATGTGTGGTTGCTCTCTCGAGAGAGCAACCACACATACGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-867s21c1
Sequence:CCGGCAAATATTTCCCTTCCGTCTTCTCGAGAAGACGGAAGGGAAATATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-907s21c1
Sequence:CCGGCCCATGTTGTTGAGAGGTCTTCTCGAGAAGACCTCTCAACAACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-936s1c1
Sequence:CCGGCTCAACTCAAGCATAGAGGATCTCGAGATCCTCTATGCTTGAGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1001s1c1
Sequence:CCGGCCAAGCCATTTAATGACCTCACTCGAGTGAGGTCATTAAATGGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-851s1c1
Sequence:CCGGGAAGAACACAAATGGCCAAATCTCGAGATTTGGCCATTTGTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1005s1c1
Sequence:CCGGGCCATTTAATGACCTCAGTTTCTCGAGAAACTGAGGTCATTAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-946s1c1
Sequence:CCGGGCATAGAGGATTCTTCTGTCTCTCGAGAGACAGAAGAATCCTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178349
LCE1B MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-947s1c1
Sequence:CCGGCATAGAGGATTCTTCTGTCTTCTCGAGAAGACAGAAGAATCCTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-1024s21c1
Sequence:CCGGTTGCGTATGTGTGGTTGCTCTCTCGAGAGAGCAACCACACATACGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-867s21c1
Sequence:CCGGCAAATATTTCCCTTCCGTCTTCTCGAGAAGACGGAAGGGAAATATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178349.1-907s21c1
Sequence:CCGGCCCATGTTGTTGAGAGGTCTTCTCGAGAAGACCTCTCAACAACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-936s1c1
Sequence:CCGGCTCAACTCAAGCATAGAGGATCTCGAGATCCTCTATGCTTGAGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1001s1c1
Sequence:CCGGCCAAGCCATTTAATGACCTCACTCGAGTGAGGTCATTAAATGGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-851s1c1
Sequence:CCGGGAAGAACACAAATGGCCAAATCTCGAGATTTGGCCATTTGTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-1005s1c1
Sequence:CCGGGCCATTTAATGACCTCAGTTTCTCGAGAAACTGAGGTCATTAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178349.1-946s1c1
Sequence:CCGGGCATAGAGGATTCTTCTGTCTCTCGAGAGACAGAAGAATCCTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026822
LCE1B MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-232s21c1
Sequence:CCGGGGTTGTTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-364s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAGCAGTCTCGAGACTGCTGCCACCACTGCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-208s21c1
Sequence:CCGGTCCTGCTGTAGCCTGGGTTCTCTCGAGAGAACCCAGGCTACAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-261s21c1
Sequence:CCGGCTGTAGCTCTGGTGGTTGCTGCTCGAGCAGCAACCACCAGAGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-451s21c1
Sequence:CCGGTGTGGCAGTAGCCAGCAGTCTCTCGAGAGACTGCTGGCTACTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026822
LCE1B MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-232s21c1
Sequence:CCGGGGTTGTTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-364s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAGCAGTCTCGAGACTGCTGCCACCACTGCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-208s21c1
Sequence:CCGGTCCTGCTGTAGCCTGGGTTCTCTCGAGAGAACCCAGGCTACAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-261s21c1
Sequence:CCGGCTGTAGCTCTGGTGGTTGCTGCTCGAGCAGCAACCACCAGAGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-451s21c1
Sequence:CCGGTGTGGCAGTAGCCAGCAGTCTCTCGAGAGACTGCTGGCTACTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026822
LCE1B MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-232s21c1
Sequence:CCGGGGTTGTTGTGGCTCCAGCTCTCTCGAGAGAGCTGGAGCCACAACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-364s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAGCAGTCTCGAGACTGCTGCCACCACTGCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-208s21c1
Sequence:CCGGTCCTGCTGTAGCCTGGGTTCTCTCGAGAGAACCCAGGCTACAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-261s21c1
Sequence:CCGGCTGTAGCTCTGGTGGTTGCTGCTCGAGCAGCAACCACCAGAGCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026822.1-451s21c1
Sequence:CCGGTGTGGCAGTAGCCAGCAGTCTCTCGAGAGACTGCTGGCTACTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)