EMAIL THIS PAGE TO A FRIEND

LCE1C

late cornified envelope 1C

25 Gene Product Result for
Synonyms: LEP3
UniProtKB ID: Q5T751
Gene ID:
Mouse(73719) late cornified envelope 1C
Rat(685998) late cornified envelope 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178351 Rosetta Predictions human pricing
NM_028622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206524 predicted 408
2 SASI_Hs01_00206525 predicted 409
3 SASI_Hs01_00206526 predicted 433
4 SASI_Hs01_00206527 predicted 438
5 SASI_Hs01_00206528 predicted 417
6 SASI_Hs01_00206529 predicted 430
7 SASI_Hs01_00206530 predicted 425
8 SASI_Hs01_00206531 predicted 436
9 SASI_Hs01_00206532 predicted 422
10 SASI_Hs01_00206533 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334114 predicted 515
2 SASI_Mm02_00334115 predicted 688
3 SASI_Mm02_00334116 predicted 614
4 SASI_Mm02_00334117 predicted 657
5 SASI_Mm02_00334118 predicted 512
6 SASI_Mm02_00334119 predicted 514
7 SASI_Mm02_00334120 predicted 506
8 SASI_Mm02_00334121 predicted 654
9 SASI_Mm02_00334122 predicted 515
10 SASI_Mm02_00334123 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028622
LCE1C MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028622.2-524s21c1
Sequence:CCGGCCATGAAGATCTCAAACATTCCTCGAGGAATGTTTGAGATCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-512s21c1
Sequence:CCGGTGCTGACAAGTGCCATGAAGACTCGAGTCTTCATGGCACTTGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-500s21c1
Sequence:CCGGTCTGGAGACTGCTGCTGACAACTCGAGTTGTCAGCAGCAGTCTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-345s21c1
Sequence:CCGGATCGTCACAGCTCTGGATGCTCTCGAGAGCATCCAGAGCTGTGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-334s21c1
Sequence:CCGGTCTTCATCGCCATCGTCACAGCTCGAGCTGTGACGATGGCGATGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028622
LCE1C MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028622.2-524s21c1
Sequence:CCGGCCATGAAGATCTCAAACATTCCTCGAGGAATGTTTGAGATCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-512s21c1
Sequence:CCGGTGCTGACAAGTGCCATGAAGACTCGAGTCTTCATGGCACTTGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-500s21c1
Sequence:CCGGTCTGGAGACTGCTGCTGACAACTCGAGTTGTCAGCAGCAGTCTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-345s21c1
Sequence:CCGGATCGTCACAGCTCTGGATGCTCTCGAGAGCATCCAGAGCTGTGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-334s21c1
Sequence:CCGGTCTTCATCGCCATCGTCACAGCTCGAGCTGTGACGATGGCGATGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028622
LCE1C MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028622.2-524s21c1
Sequence:CCGGCCATGAAGATCTCAAACATTCCTCGAGGAATGTTTGAGATCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-512s21c1
Sequence:CCGGTGCTGACAAGTGCCATGAAGACTCGAGTCTTCATGGCACTTGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-500s21c1
Sequence:CCGGTCTGGAGACTGCTGCTGACAACTCGAGTTGTCAGCAGCAGTCTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-345s21c1
Sequence:CCGGATCGTCACAGCTCTGGATGCTCTCGAGAGCATCCAGAGCTGTGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028622.2-334s21c1
Sequence:CCGGTCTTCATCGCCATCGTCACAGCTCGAGCTGTGACGATGGCGATGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178351
LCE1C MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-432s21c1
Sequence:CCGGCAGAATCCAGGACCGCAAACTCTCGAGAGTTTGCGGTCCTGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-503s21c1
Sequence:CCGGTCCAAGGGAAAGCTCTGAACTCTCGAGAGTTCAGAGCTTTCCCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-488s21c1
Sequence:CCGGTGAGAGGCTCACAGGTCCAAGCTCGAGCTTGGACCTGTGAGCCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-518s21c1
Sequence:CCGGTGAACTTGCCAAGAGCATATCCTCGAGGATATGCTCTTGGCAAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-443s21c1
Sequence:CCGGACCGCAAACTGCCAAGGACATCTCGAGATGTCCTTGGCAGTTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178351
LCE1C MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-432s21c1
Sequence:CCGGCAGAATCCAGGACCGCAAACTCTCGAGAGTTTGCGGTCCTGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-503s21c1
Sequence:CCGGTCCAAGGGAAAGCTCTGAACTCTCGAGAGTTCAGAGCTTTCCCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-488s21c1
Sequence:CCGGTGAGAGGCTCACAGGTCCAAGCTCGAGCTTGGACCTGTGAGCCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-518s21c1
Sequence:CCGGTGAACTTGCCAAGAGCATATCCTCGAGGATATGCTCTTGGCAAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-443s21c1
Sequence:CCGGACCGCAAACTGCCAAGGACATCTCGAGATGTCCTTGGCAGTTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178351
LCE1C MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-432s21c1
Sequence:CCGGCAGAATCCAGGACCGCAAACTCTCGAGAGTTTGCGGTCCTGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-503s21c1
Sequence:CCGGTCCAAGGGAAAGCTCTGAACTCTCGAGAGTTCAGAGCTTTCCCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-488s21c1
Sequence:CCGGTGAGAGGCTCACAGGTCCAAGCTCGAGCTTGGACCTGTGAGCCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-518s21c1
Sequence:CCGGTGAACTTGCCAAGAGCATATCCTCGAGGATATGCTCTTGGCAAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178351.3-443s21c1
Sequence:CCGGACCGCAAACTGCCAAGGACATCTCGAGATGTCCTTGGCAGTTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)