EMAIL THIS PAGE TO A FRIEND

LCE1D

late cornified envelope 1D

16 Gene Product Result for
Synonyms: LEP4
UniProtKB ID: Q5T752
Gene ID:
Mouse(69611) late cornified envelope 1D
Rat(685981) late cornified envelope 1D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178352 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216061 MISSION® esiRNA esiRNA targeting mouse Lce1d mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_027137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123302 predicted 596
2 SASI_Mm01_00123303 predicted 594
3 SASI_Mm01_00123304 predicted 579
4 SASI_Mm01_00123305 predicted 626
5 SASI_Mm01_00123306 predicted 594
6 SASI_Mm02_00331637 predicted 643
7 SASI_Mm01_00123307 predicted 512
8 SASI_Mm01_00123309 predicted 626
9 SASI_Mm01_00123310 predicted 571
10 SASI_Mm01_00123311 predicted 464
11 SASI_Mm01_00123308 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027137
LCE1D MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027137.2-478s21c1
Sequence:CCGGCAATGAGAAAGAATCTAGAAACTCGAGTTTCTAGATTCTTTCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-468s21c1
Sequence:CCGGCTGCTGATCTCAATGAGAAAGCTCGAGCTTTCTCATTGAGATCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-174s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAATGCTCGAGCATTTGGGAGGACACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-344s21c1
Sequence:CCGGACAGATCTCTTCGTCGCCATCCTCGAGGATGGCGACGAAGAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-334s21c1
Sequence:CCGGCACAGGCCTCACAGATCTCTTCTCGAGAAGAGATCTGTGAGGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027137
LCE1D MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027137.2-478s21c1
Sequence:CCGGCAATGAGAAAGAATCTAGAAACTCGAGTTTCTAGATTCTTTCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-468s21c1
Sequence:CCGGCTGCTGATCTCAATGAGAAAGCTCGAGCTTTCTCATTGAGATCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-174s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAATGCTCGAGCATTTGGGAGGACACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-344s21c1
Sequence:CCGGACAGATCTCTTCGTCGCCATCCTCGAGGATGGCGACGAAGAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-334s21c1
Sequence:CCGGCACAGGCCTCACAGATCTCTTCTCGAGAAGAGATCTGTGAGGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027137
LCE1D MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027137.2-478s21c1
Sequence:CCGGCAATGAGAAAGAATCTAGAAACTCGAGTTTCTAGATTCTTTCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-468s21c1
Sequence:CCGGCTGCTGATCTCAATGAGAAAGCTCGAGCTTTCTCATTGAGATCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-174s21c1
Sequence:CCGGCCCTAAGTGTCCTCCCAAATGCTCGAGCATTTGGGAGGACACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-344s21c1
Sequence:CCGGACAGATCTCTTCGTCGCCATCCTCGAGGATGGCGACGAAGAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027137.2-334s21c1
Sequence:CCGGCACAGGCCTCACAGATCTCTTCTCGAGAAGAGATCTGTGAGGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178352
LCE1D MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1D
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-81s21c1
Sequence:CCGGCTCCCAAGTGCACTCCCAAGTCTCGAGACTTGGGAGTGCACTTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-165s21c1
Sequence:CCGGGTGTCAGCTCCGGAGGCTGCTCTCGAGAGCAGCCTCCGGAGCTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-150s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGTGTCACTCGAGTGACACTGCAGCAGGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-136s21c1
Sequence:CCGGTAAGTGCCCTCCAGTCTCTTCCTCGAGGAAGAGACTGGAGGGCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178352
LCE1D MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1D
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-81s21c1
Sequence:CCGGCTCCCAAGTGCACTCCCAAGTCTCGAGACTTGGGAGTGCACTTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-165s21c1
Sequence:CCGGGTGTCAGCTCCGGAGGCTGCTCTCGAGAGCAGCCTCCGGAGCTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-150s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGTGTCACTCGAGTGACACTGCAGCAGGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-136s21c1
Sequence:CCGGTAAGTGCCCTCCAGTCTCTTCCTCGAGGAAGAGACTGGAGGGCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178352
LCE1D MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1D
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-81s21c1
Sequence:CCGGCTCCCAAGTGCACTCCCAAGTCTCGAGACTTGGGAGTGCACTTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-165s21c1
Sequence:CCGGGTGTCAGCTCCGGAGGCTGCTCTCGAGAGCAGCCTCCGGAGCTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-150s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGTGTCACTCGAGTGACACTGCAGCAGGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178352.2-136s21c1
Sequence:CCGGTAAGTGCCCTCCAGTCTCTTCCTCGAGGAAGAGACTGGAGGGCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)