EMAIL THIS PAGE TO A FRIEND

LCE1E

late cornified envelope 1E

23 Gene Product Result for
Synonyms: LEP5
UniProtKB ID: Q5T753, D3DV30
Gene ID:
Mouse(68694) late cornified envelope 1E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178353 Rosetta Predictions human pricing
NM_026811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171463 predicted 436
2 SASI_Hs01_00171464 predicted 497
3 SASI_Hs01_00171465 predicted 496
4 SASI_Hs01_00171466 predicted 443
5 SASI_Hs01_00171467 predicted 577
6 SASI_Hs01_00171469 predicted 523
7 SASI_Hs01_00171470 predicted 526
8 SASI_Hs01_00171471 predicted 539
9 SASI_Hs01_00171472 predicted 435
10 SASI_Hs02_00369644 predicted 431
11 SASI_Hs01_00171468 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062335 predicted 640
2 SASI_Mm01_00062336 predicted 629
3 SASI_Mm01_00062337 predicted 529
4 SASI_Mm01_00062339 predicted 627
5 SASI_Mm01_00062340 predicted 592
6 SASI_Mm01_00062341 predicted 632
7 SASI_Mm01_00062342 predicted 624
8 SASI_Mm01_00062338 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026811
LCE1E MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1E
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026811.2-528s21c1
Sequence:CCGGCAAATGGGACAGGAGGAACATCTCGAGATGTTCCTCCTGTCCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-139s1c1
Sequence:CCGGCCAAATGCCAGATCCCAAAGTCTCGAGACTTTGGGATCTGGCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-552s1c1
Sequence:CCGGGCTCAGAAGATTCTCCATTGTCTCGAGACAATGGAGAATCTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-140s1c1
Sequence:CCGGCAAATGCCAGATCCCAAAGTGCTCGAGCACTTTGGGATCTGGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-130s21c1
Sequence:CCGGATGCCCTCCCAAATGCCAGATCTCGAGATCTGGCATTTGGGAGGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-148s21c1
Sequence:CCGGGATCCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-553s1c1
Sequence:CCGGCTCAGAAGATTCTCCATTGTTCTCGAGAACAATGGAGAATCTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-505s21c1
Sequence:CCGGAGCTGGGTGAGGAAGACTTCACTCGAGTGAAGTCTTCCTCACCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-209s21c1
Sequence:CCGGTCCTGCTGTAGCTTGGGTTCTCTCGAGAGAACCCAAGCTACAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026811
LCE1E MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1E
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026811.2-528s21c1
Sequence:CCGGCAAATGGGACAGGAGGAACATCTCGAGATGTTCCTCCTGTCCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-139s1c1
Sequence:CCGGCCAAATGCCAGATCCCAAAGTCTCGAGACTTTGGGATCTGGCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-552s1c1
Sequence:CCGGGCTCAGAAGATTCTCCATTGTCTCGAGACAATGGAGAATCTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-140s1c1
Sequence:CCGGCAAATGCCAGATCCCAAAGTGCTCGAGCACTTTGGGATCTGGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-130s21c1
Sequence:CCGGATGCCCTCCCAAATGCCAGATCTCGAGATCTGGCATTTGGGAGGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-148s21c1
Sequence:CCGGGATCCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-553s1c1
Sequence:CCGGCTCAGAAGATTCTCCATTGTTCTCGAGAACAATGGAGAATCTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-505s21c1
Sequence:CCGGAGCTGGGTGAGGAAGACTTCACTCGAGTGAAGTCTTCCTCACCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-209s21c1
Sequence:CCGGTCCTGCTGTAGCTTGGGTTCTCTCGAGAGAACCCAAGCTACAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026811
LCE1E MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1E
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026811.2-528s21c1
Sequence:CCGGCAAATGGGACAGGAGGAACATCTCGAGATGTTCCTCCTGTCCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-139s1c1
Sequence:CCGGCCAAATGCCAGATCCCAAAGTCTCGAGACTTTGGGATCTGGCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-552s1c1
Sequence:CCGGGCTCAGAAGATTCTCCATTGTCTCGAGACAATGGAGAATCTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026811.1-140s1c1
Sequence:CCGGCAAATGCCAGATCCCAAAGTGCTCGAGCACTTTGGGATCTGGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-130s21c1
Sequence:CCGGATGCCCTCCCAAATGCCAGATCTCGAGATCTGGCATTTGGGAGGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-148s21c1
Sequence:CCGGGATCCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026811.1-553s1c1
Sequence:CCGGCTCAGAAGATTCTCCATTGTTCTCGAGAACAATGGAGAATCTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-505s21c1
Sequence:CCGGAGCTGGGTGAGGAAGACTTCACTCGAGTGAAGTCTTCCTCACCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026811.2-209s21c1
Sequence:CCGGTCCTGCTGTAGCTTGGGTTCTCTCGAGAGAACCCAAGCTACAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178353
LCE1E MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-536s21c1
Sequence:CCGGTAATGGCATTTAGAGACTTTCCTCGAGGAAAGTCTCTAAATGCCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-897s1c1
Sequence:CCGGCTGGTTCCTTTCACCTATGTACTCGAGTACATAGGTGAAAGGAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-999s1c1
Sequence:CCGGCCCACTCCTTCCACTAACAATCTCGAGATTGTTAGTGGAAGGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-474s1c1
Sequence:CCGGCTTGAAGTCTTGCCTGGAGAACTCGAGTTCTCCAGGCAAGACTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-613s21c1
Sequence:CCGGAGCTCACGCTGCTGTATTCTGCTCGAGCAGAATACAGCAGCGTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-451s21c1
Sequence:CCGGTAGCTGAGAGGTTCCAGCAAACTCGAGTTTGCTGGAACCTCTCAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-887s1c1
Sequence:CCGGCTTTCAAATTCTGGTTCCTTTCTCGAGAAAGGAACCAGAATTTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-1054s1c1
Sequence:CCGGGCATTCACACACACATATGTACTCGAGTACATATGTGTGTGTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-635s1c1
Sequence:CCGGGCTGCCTGAACTGAAGAAATACTCGAGTATTTCTTCAGTTCAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-421s1c1
Sequence:CCGGGACTTCCTCTTCCTTCTGATTCTCGAGAATCAGAAGGAAGAGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-853s1c1
Sequence:CCGGCCAAGGGACTGAAATAGCATTCTCGAGAATGCTATTTCAGTCCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178353
LCE1E MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-536s21c1
Sequence:CCGGTAATGGCATTTAGAGACTTTCCTCGAGGAAAGTCTCTAAATGCCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-897s1c1
Sequence:CCGGCTGGTTCCTTTCACCTATGTACTCGAGTACATAGGTGAAAGGAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-999s1c1
Sequence:CCGGCCCACTCCTTCCACTAACAATCTCGAGATTGTTAGTGGAAGGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-474s1c1
Sequence:CCGGCTTGAAGTCTTGCCTGGAGAACTCGAGTTCTCCAGGCAAGACTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-613s21c1
Sequence:CCGGAGCTCACGCTGCTGTATTCTGCTCGAGCAGAATACAGCAGCGTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-451s21c1
Sequence:CCGGTAGCTGAGAGGTTCCAGCAAACTCGAGTTTGCTGGAACCTCTCAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-887s1c1
Sequence:CCGGCTTTCAAATTCTGGTTCCTTTCTCGAGAAAGGAACCAGAATTTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-1054s1c1
Sequence:CCGGGCATTCACACACACATATGTACTCGAGTACATATGTGTGTGTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-635s1c1
Sequence:CCGGGCTGCCTGAACTGAAGAAATACTCGAGTATTTCTTCAGTTCAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-421s1c1
Sequence:CCGGGACTTCCTCTTCCTTCTGATTCTCGAGAATCAGAAGGAAGAGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-853s1c1
Sequence:CCGGCCAAGGGACTGAAATAGCATTCTCGAGAATGCTATTTCAGTCCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178353
LCE1E MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-536s21c1
Sequence:CCGGTAATGGCATTTAGAGACTTTCCTCGAGGAAAGTCTCTAAATGCCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-897s1c1
Sequence:CCGGCTGGTTCCTTTCACCTATGTACTCGAGTACATAGGTGAAAGGAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-999s1c1
Sequence:CCGGCCCACTCCTTCCACTAACAATCTCGAGATTGTTAGTGGAAGGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-474s1c1
Sequence:CCGGCTTGAAGTCTTGCCTGGAGAACTCGAGTTCTCCAGGCAAGACTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-613s21c1
Sequence:CCGGAGCTCACGCTGCTGTATTCTGCTCGAGCAGAATACAGCAGCGTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178353.1-451s21c1
Sequence:CCGGTAGCTGAGAGGTTCCAGCAAACTCGAGTTTGCTGGAACCTCTCAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-887s1c1
Sequence:CCGGCTTTCAAATTCTGGTTCCTTTCTCGAGAAAGGAACCAGAATTTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-1054s1c1
Sequence:CCGGGCATTCACACACACATATGTACTCGAGTACATATGTGTGTGTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-635s1c1
Sequence:CCGGGCTGCCTGAACTGAAGAAATACTCGAGTATTTCTTCAGTTCAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-421s1c1
Sequence:CCGGGACTTCCTCTTCCTTCTGATTCTCGAGAATCAGAAGGAAGAGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178353.1-853s1c1
Sequence:CCGGCCAAGGGACTGAAATAGCATTCTCGAGAATGCTATTTCAGTCCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)