EMAIL THIS PAGE TO A FRIEND

LCE1F

late cornified envelope 1F

29 Gene Product Result for
Synonyms: LEP6
UniProtKB ID: Q5T754
Gene ID:
Mouse(67828) late cornified envelope 1F
Rat(499663) late cornified envelope 1F
naked mole-rat(101724204) late cornified envelope 1F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149211 MISSION® esiRNA esiRNA human LCE1F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178354 Rosetta Predictions human pricing
NM_001109188 Rosetta Predictions rat pricing
NM_026394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135122 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245990 predicted 596
2 SASI_Rn02_00245991 predicted 612
3 SASI_Rn02_00245992 predicted 608
4 SASI_Rn02_00245993 predicted 454
5 SASI_Rn02_00245994 predicted 607
6 SASI_Rn02_00245995 predicted 447
7 SASI_Rn02_00245996 predicted 603
8 SASI_Rn02_00245997 predicted 604
9 SASI_Rn02_00245998 predicted 593
10 SASI_Rn02_00245999 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068604 predicted 671
2 SASI_Mm01_00068605 predicted 644
3 SASI_Mm01_00068606 predicted 669
4 SASI_Mm01_00068607 predicted 659
5 SASI_Mm01_00068608 predicted 671
6 SASI_Mm01_00068609 predicted 494
7 SASI_Mm01_00068611 predicted 644
8 SASI_Mm01_00068612 predicted 665
9 SASI_Mm01_00068613 predicted 657
10 SASI_Mm02_00330166 predicted 625
11 SASI_Mm01_00068610 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026394
LCE1F MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-139s21c1
Sequence:CCGGGACTCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-127s21c1
Sequence:CCGGTCCCAAGTGCCAGACTCCAAACTCGAGTTTGGAGTCTGGCACTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026394.3-515s21c1
Sequence:CCGGTGAGGAAGACTTCGGACAAATCTCGAGATTTGTCCGAAGTCTTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-337s21c1
Sequence:CCGGTCGTCACAGCTCTGGATGTTGCTCGAGCAACATCCAGAGCTGTGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-496s21c1
Sequence:CCGGGGATTGCTGCTGACCTGTATGCTCGAGCATACAGGTCAGCAGCAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026394
LCE1F MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-139s21c1
Sequence:CCGGGACTCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-127s21c1
Sequence:CCGGTCCCAAGTGCCAGACTCCAAACTCGAGTTTGGAGTCTGGCACTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026394.3-515s21c1
Sequence:CCGGTGAGGAAGACTTCGGACAAATCTCGAGATTTGTCCGAAGTCTTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-337s21c1
Sequence:CCGGTCGTCACAGCTCTGGATGTTGCTCGAGCAACATCCAGAGCTGTGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-496s21c1
Sequence:CCGGGGATTGCTGCTGACCTGTATGCTCGAGCATACAGGTCAGCAGCAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026394
LCE1F MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-139s21c1
Sequence:CCGGGACTCCAAAGTGCCCTCCAAACTCGAGTTTGGAGGGCACTTTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-127s21c1
Sequence:CCGGTCCCAAGTGCCAGACTCCAAACTCGAGTTTGGAGTCTGGCACTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026394.3-515s21c1
Sequence:CCGGTGAGGAAGACTTCGGACAAATCTCGAGATTTGTCCGAAGTCTTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-337s21c1
Sequence:CCGGTCGTCACAGCTCTGGATGTTGCTCGAGCAACATCCAGAGCTGTGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026394.3-496s21c1
Sequence:CCGGGGATTGCTGCTGACCTGTATGCTCGAGCATACAGGTCAGCAGCAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178354
LCE1F MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 1F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-136s21c1
Sequence:CCGGGTCAGCTCCGGAGGCTGCTGTCTCGAGACAGCAGCCTCCGGAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCTGTCTCTTCTCGAGAAGAGACAGGAGGGCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-39s21c1
Sequence:CCGGTCCCAAGTGCACTCCCAAGTGCTCGAGCACTTGGGAGTGCACTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-119s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGCGTCACTCGAGTGACGCTGCAGCAGGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-51s21c1
Sequence:CCGGTCCCAAGTGCCCTCCCAAGTGCTCGAGCACTTGGGAGGGCACTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178354
LCE1F MISSION shRNA shRNA Plasmid DNA
late cornified envelope 1F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-136s21c1
Sequence:CCGGGTCAGCTCCGGAGGCTGCTGTCTCGAGACAGCAGCCTCCGGAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCTGTCTCTTCTCGAGAAGAGACAGGAGGGCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-39s21c1
Sequence:CCGGTCCCAAGTGCACTCCCAAGTGCTCGAGCACTTGGGAGTGCACTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-119s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGCGTCACTCGAGTGACGCTGCAGCAGGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-51s21c1
Sequence:CCGGTCCCAAGTGCCCTCCCAAGTGCTCGAGCACTTGGGAGGGCACTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178354
LCE1F MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 1F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-136s21c1
Sequence:CCGGGTCAGCTCCGGAGGCTGCTGTCTCGAGACAGCAGCCTCCGGAGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-104s21c1
Sequence:CCGGCTAAGTGCCCTCCTGTCTCTTCTCGAGAAGAGACAGGAGGGCACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-39s21c1
Sequence:CCGGTCCCAAGTGCACTCCCAAGTGCTCGAGCACTTGGGAGTGCACTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-119s21c1
Sequence:CCGGTCTCTTCCTGCTGCAGCGTCACTCGAGTGACGCTGCAGCAGGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178354.1-51s21c1
Sequence:CCGGTCCCAAGTGCCCTCCCAAGTGCTCGAGCACTTGGGAGGGCACTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)