EMAIL THIS PAGE TO A FRIEND

Lce1g

11 Gene Product Result for
Species: Mouse Lce1g(66195)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU189981 MISSION® esiRNA targeting mouse Lce1g mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059946 predicted 739
2 SASI_Mm01_00059948 predicted 790
3 SASI_Mm01_00059950 predicted 749
4 SASI_Mm01_00059952 predicted 820
5 SASI_Mm01_00059953 predicted 682
6 SASI_Mm01_00059954 predicted 511
7 SASI_Mm01_00059955 predicted 736
8 SASI_Mm01_00059947 predicted 123
9 SASI_Mm01_00059949 predicted 779
10 SASI_Mm01_00059951 predicted 124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025413
Lce1g MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-533s21c1
Sequence:CCGGGAACACGCTCAGAAGACTCTCCTCGAGGAGAGTCTTCTGAGCGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-651s1c1
Sequence:CCGGGACAATGACCATTTGCCTCTTCTCGAGAAGAGGCAAATGGTCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-597s1c1
Sequence:CCGGCCCTCTGAGTTGCTGAAATCTCTCGAGAGATTTCAGCAACTCAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-691s21c1
Sequence:CCGGTCTTGACGACCATTCCTTAAACTCGAGTTTAAGGAATGGTCGTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-743s21c1
Sequence:CCGGCCTGTTTCTTGTCATGTATTACTCGAGTAATACATGACAAGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-730s21c1
Sequence:CCGGTTCTTTGGCCCATCCTGTTTCCTCGAGGAAACAGGATGGGCCAAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-738s1c1
Sequence:CCGGGCCCATCCTGTTTCTTGTCATCTCGAGATGACAAGAAACAGGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-546s21c1
Sequence:CCGGAGACTCTCCATTGGGTGATGTCTCGAGACATCACCCAATGGAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025413
Lce1g MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-533s21c1
Sequence:CCGGGAACACGCTCAGAAGACTCTCCTCGAGGAGAGTCTTCTGAGCGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-651s1c1
Sequence:CCGGGACAATGACCATTTGCCTCTTCTCGAGAAGAGGCAAATGGTCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-597s1c1
Sequence:CCGGCCCTCTGAGTTGCTGAAATCTCTCGAGAGATTTCAGCAACTCAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-691s21c1
Sequence:CCGGTCTTGACGACCATTCCTTAAACTCGAGTTTAAGGAATGGTCGTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-743s21c1
Sequence:CCGGCCTGTTTCTTGTCATGTATTACTCGAGTAATACATGACAAGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-730s21c1
Sequence:CCGGTTCTTTGGCCCATCCTGTTTCCTCGAGGAAACAGGATGGGCCAAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-738s1c1
Sequence:CCGGGCCCATCCTGTTTCTTGTCATCTCGAGATGACAAGAAACAGGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-546s21c1
Sequence:CCGGAGACTCTCCATTGGGTGATGTCTCGAGACATCACCCAATGGAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025413
Lce1g MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-533s21c1
Sequence:CCGGGAACACGCTCAGAAGACTCTCCTCGAGGAGAGTCTTCTGAGCGTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-651s1c1
Sequence:CCGGGACAATGACCATTTGCCTCTTCTCGAGAAGAGGCAAATGGTCATTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-597s1c1
Sequence:CCGGCCCTCTGAGTTGCTGAAATCTCTCGAGAGATTTCAGCAACTCAGAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-691s21c1
Sequence:CCGGTCTTGACGACCATTCCTTAAACTCGAGTTTAAGGAATGGTCGTCAAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-743s21c1
Sequence:CCGGCCTGTTTCTTGTCATGTATTACTCGAGTAATACATGACAAGAAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-730s21c1
Sequence:CCGGTTCTTTGGCCCATCCTGTTTCCTCGAGGAAACAGGATGGGCCAAAGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000202242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025413.1-738s1c1
Sequence:CCGGGCCCATCCTGTTTCTTGTCATCTCGAGATGACAAGAAACAGGATGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025413.2-546s21c1
Sequence:CCGGAGACTCTCCATTGGGTGATGTCTCGAGACATCACCCAATGGAGAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???