EMAIL THIS PAGE TO A FRIEND

Lce1h

1 Gene Product Result for
Species: Mouse Lce1h(67718)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216741 MISSION® esiRNA targeting mouse Lce1h mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026335
VALIDATED
Lce1h MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-204s21c1
Sequence:CCGGTGCTGTAGCTTGGGTTCTGGTCTCGAGACCAGAACCCAAGCTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-503s21c1
Sequence:CCGGTGGGTGAGGAAGACTTCAAACCTCGAGGTTTGAAGTCTTCCTCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-345s21c1
Sequence:CCGGAGATCTCTTCGTCGCCATCGTCTCGAGACGATGGCGACGAAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-381s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAACAGTCTCGAGACTGTTGCCACCACTGCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-533s21c1
Sequence:CCGGAGGAGGAGCACATGCTCAGAACTCGAGTTCTGAGCATGTGCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026335
VALIDATED
Lce1h MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-204s21c1
Sequence:CCGGTGCTGTAGCTTGGGTTCTGGTCTCGAGACCAGAACCCAAGCTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-503s21c1
Sequence:CCGGTGGGTGAGGAAGACTTCAAACCTCGAGGTTTGAAGTCTTCCTCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-345s21c1
Sequence:CCGGAGATCTCTTCGTCGCCATCGTCTCGAGACGATGGCGACGAAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-381s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAACAGTCTCGAGACTGTTGCCACCACTGCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-533s21c1
Sequence:CCGGAGGAGGAGCACATGCTCAGAACTCGAGTTCTGAGCATGTGCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026335
VALIDATED
Lce1h MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-204s21c1
Sequence:CCGGTGCTGTAGCTTGGGTTCTGGTCTCGAGACCAGAACCCAAGCTACAGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-503s21c1
Sequence:CCGGTGGGTGAGGAAGACTTCAAACCTCGAGGTTTGAAGTCTTCCTCACCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-345s21c1
Sequence:CCGGAGATCTCTTCGTCGCCATCGTCTCGAGACGATGGCGACGAAGAGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-381s21c1
Sequence:CCGGTGTAGCAGTGGTGGCAACAGTCTCGAGACTGTTGCCACCACTGCTACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026335.2-533s21c1
Sequence:CCGGAGGAGGAGCACATGCTCAGAACTCGAGTTCTGAGCATGTGCTCCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???