EMAIL THIS PAGE TO A FRIEND

LCE2A

late cornified envelope 2A

14 Gene Product Result for
Synonyms: LEP9
Species: Human LCE2A(353139)
UniProtKB ID: Q5TA79, A4QMZ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165151 predicted 305
2 SASI_Hs01_00165152 predicted 540
3 SASI_Hs01_00165153 predicted 368
4 SASI_Hs01_00165154 predicted 519
5 SASI_Hs02_00369662 predicted 534
6 SASI_Hs01_00165156 predicted 547
7 SASI_Hs01_00165157 predicted 526
8 SASI_Hs01_00165158 predicted 391
9 SASI_Hs01_00165159 predicted 541
10 SASI_Hs01_00165160 predicted 382
11 SASI_Hs01_00165155 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178428
LCE2A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 2A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-123s21c1
Sequence:CCGGTCCTCCAAAGTGCCGACCTCACTCGAGTGAGGTCGGCACTTTGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-379s21c1
Sequence:CCGGCTCGAACATCACAGAGCAACCCTCGAGGGTTGCTCTGTGATGTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-367s21c1
Sequence:CCGGTGCTGACCAGACCTCGAACATCTCGAGATGTTCGAGGTCTGGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-392s21c1
Sequence:CCGGGAGCAACCCTTATGGAGAAACCTCGAGGTTTCTCCATAAGGGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178428.2-278s1c1
Sequence:CCGGGATTGTTGTGAGTGTGAACCTCTCGAGAGGTTCACACTCACAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178428.2-365s1c1
Sequence:CCGGGCAACCCTTATGGAGAAACTTCTCGAGAAGTTTCTCCATAAGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178428
LCE2A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 2A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-123s21c1
Sequence:CCGGTCCTCCAAAGTGCCGACCTCACTCGAGTGAGGTCGGCACTTTGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-379s21c1
Sequence:CCGGCTCGAACATCACAGAGCAACCCTCGAGGGTTGCTCTGTGATGTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-367s21c1
Sequence:CCGGTGCTGACCAGACCTCGAACATCTCGAGATGTTCGAGGTCTGGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-392s21c1
Sequence:CCGGGAGCAACCCTTATGGAGAAACCTCGAGGTTTCTCCATAAGGGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178428.2-278s1c1
Sequence:CCGGGATTGTTGTGAGTGTGAACCTCTCGAGAGGTTCACACTCACAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178428.2-365s1c1
Sequence:CCGGGCAACCCTTATGGAGAAACTTCTCGAGAAGTTTCTCCATAAGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178428
LCE2A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 2A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-123s21c1
Sequence:CCGGTCCTCCAAAGTGCCGACCTCACTCGAGTGAGGTCGGCACTTTGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-379s21c1
Sequence:CCGGCTCGAACATCACAGAGCAACCCTCGAGGGTTGCTCTGTGATGTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178428.3-367s21c1
Sequence:CCGGTGCTGACCAGACCTCGAACATCTCGAGATGTTCGAGGTCTGGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178428.3-392s21c1
Sequence:CCGGGAGCAACCCTTATGGAGAAACCTCGAGGTTTCTCCATAAGGGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178428.2-278s1c1
Sequence:CCGGGATTGTTGTGAGTGTGAACCTCTCGAGAGGTTCACACTCACAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178428.2-365s1c1
Sequence:CCGGGCAACCCTTATGGAGAAACTTCTCGAGAAGTTTCTCCATAAGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)