EMAIL THIS PAGE TO A FRIEND

LCE2B

late cornified envelope 2B

14 Gene Product Result for
Synonyms: LEP10 SPRL1B XP5
Species: Human LCE2B(26239)
UniProtKB ID: O14633, Q5TA80
Gene ID:
Human(26239) Summary: This gene is one of the at least 20 genes expressed during epidermal differentiation and located on chromosomal band 1q21. This gene is involved in epidermal differentiation, and it is expressed at high levels in normal and psoriatic skin, but not in cultured keratinocytes or in any other tested cell types or tissues. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301727 ANTI-LCE2B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014357 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120342 predicted 389
2 SASI_Hs01_00120343 predicted 375
3 SASI_Hs01_00120344 predicted 374
4 SASI_Hs01_00120345 predicted 434
5 SASI_Hs01_00120346 predicted 524
6 SASI_Hs01_00120347 predicted 396
7 SASI_Hs01_00120349 predicted 438
8 SASI_Hs01_00120350 predicted 523
9 SASI_Hs01_00120351 predicted 435
10 SASI_Hs02_00345503 predicted 461
11 SASI_Hs01_00120348 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014357
LCE2B MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-435s1c1
Sequence:CCGGCAGCCTGATGCTTAACCCTTTCTCGAGAAAGGGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-404s1c1
Sequence:CCGGCTCTTTGGACAGAATGTTTAACTCGAGTTAAACATTCTGTCCAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-398s1c1
Sequence:CCGGGAAGAACTCTTTGGACAGAATCTCGAGATTCTGTCCAAAGAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-401s1c1
Sequence:CCGGGAACTCTTTGGACAGAATGTTCTCGAGAACATTCTGTCCAAAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-439s1c1
Sequence:CCGGCTGATGCTTAACCCTTTCCATCTCGAGATGGAAAGGGTTAAGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014357.4-382s21c1
Sequence:CCGGTGCTGACCTGGGCTAAGAAGACTCGAGTCTTCTTAGCCCAGGTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014357.4-417s21c1
Sequence:CCGGATGTTTAAGAACCTCCTACAGCTCGAGCTGTAGGAGGTTCTTAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014357
LCE2B MISSION shRNA shRNA Plasmid DNA
late cornified envelope 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-435s1c1
Sequence:CCGGCAGCCTGATGCTTAACCCTTTCTCGAGAAAGGGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-404s1c1
Sequence:CCGGCTCTTTGGACAGAATGTTTAACTCGAGTTAAACATTCTGTCCAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-398s1c1
Sequence:CCGGGAAGAACTCTTTGGACAGAATCTCGAGATTCTGTCCAAAGAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-401s1c1
Sequence:CCGGGAACTCTTTGGACAGAATGTTCTCGAGAACATTCTGTCCAAAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-439s1c1
Sequence:CCGGCTGATGCTTAACCCTTTCCATCTCGAGATGGAAAGGGTTAAGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014357.4-382s21c1
Sequence:CCGGTGCTGACCTGGGCTAAGAAGACTCGAGTCTTCTTAGCCCAGGTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014357.4-417s21c1
Sequence:CCGGATGTTTAAGAACCTCCTACAGCTCGAGCTGTAGGAGGTTCTTAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014357
LCE2B MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-435s1c1
Sequence:CCGGCAGCCTGATGCTTAACCCTTTCTCGAGAAAGGGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-404s1c1
Sequence:CCGGCTCTTTGGACAGAATGTTTAACTCGAGTTAAACATTCTGTCCAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-398s1c1
Sequence:CCGGGAAGAACTCTTTGGACAGAATCTCGAGATTCTGTCCAAAGAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-401s1c1
Sequence:CCGGGAACTCTTTGGACAGAATGTTCTCGAGAACATTCTGTCCAAAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014357.3-439s1c1
Sequence:CCGGCTGATGCTTAACCCTTTCCATCTCGAGATGGAAAGGGTTAAGCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014357.4-382s21c1
Sequence:CCGGTGCTGACCTGGGCTAAGAAGACTCGAGTCTTCTTAGCCCAGGTCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014357.4-417s21c1
Sequence:CCGGATGTTTAAGAACCTCCTACAGCTCGAGCTGTAGGAGGTTCTTAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)