EMAIL THIS PAGE TO A FRIEND

LCE2C

late cornified envelope 2C

14 Gene Product Result for
Synonyms: LEP11
Species: Human LCE2C(353140)
UniProtKB ID: Q5TA81
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369663 predicted 515
2 SASI_Hs01_00029178 predicted 521
3 SASI_Hs01_00029179 predicted 428
4 SASI_Hs01_00029180 predicted 429
5 SASI_Hs01_00029181 predicted 466
6 SASI_Hs01_00029182 predicted 398
7 SASI_Hs01_00029183 predicted 463
8 SASI_Hs01_00029184 predicted 500
9 SASI_Hs01_00029185 predicted 430
10 SASI_Hs01_00029186 predicted 442
11 SASI_Hs01_00029187 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178429
LCE2C MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 2C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-391s21c1
Sequence:CCGGTGGGCTACAGAAGAGCTCTTGCTCGAGCAAGAGCTCTTCTGTAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-429s21c1
Sequence:CCGGACCTGCTACGGCCTGATGGATCTCGAGATCCATCAGGCCGTAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-437s21c1
Sequence:CCGGCGGCCTGATGGATACTCTTTCCTCGAGGAAAGAGTATCCATCAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-413s21c1
Sequence:CCGGGACTGAATGGCCAAGAACCTGCTCGAGCAGGTTCTTGGCCATTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-399s21c1
Sequence:CCGGAGAAGAGCTCTTGGGACTGAACTCGAGTTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178429.2-400s1c1
Sequence:CCGGGAAGAGCTCTTGGGACTGAATCTCGAGATTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178429
LCE2C MISSION shRNA shRNA Plasmid DNA
late cornified envelope 2C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-391s21c1
Sequence:CCGGTGGGCTACAGAAGAGCTCTTGCTCGAGCAAGAGCTCTTCTGTAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-429s21c1
Sequence:CCGGACCTGCTACGGCCTGATGGATCTCGAGATCCATCAGGCCGTAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-437s21c1
Sequence:CCGGCGGCCTGATGGATACTCTTTCCTCGAGGAAAGAGTATCCATCAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-413s21c1
Sequence:CCGGGACTGAATGGCCAAGAACCTGCTCGAGCAGGTTCTTGGCCATTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-399s21c1
Sequence:CCGGAGAAGAGCTCTTGGGACTGAACTCGAGTTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178429.2-400s1c1
Sequence:CCGGGAAGAGCTCTTGGGACTGAATCTCGAGATTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178429
LCE2C MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 2C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-391s21c1
Sequence:CCGGTGGGCTACAGAAGAGCTCTTGCTCGAGCAAGAGCTCTTCTGTAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-429s21c1
Sequence:CCGGACCTGCTACGGCCTGATGGATCTCGAGATCCATCAGGCCGTAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-437s21c1
Sequence:CCGGCGGCCTGATGGATACTCTTTCCTCGAGGAAAGAGTATCCATCAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-413s21c1
Sequence:CCGGGACTGAATGGCCAAGAACCTGCTCGAGCAGGTTCTTGGCCATTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178429.2-399s21c1
Sequence:CCGGAGAAGAGCTCTTGGGACTGAACTCGAGTTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178429.2-400s1c1
Sequence:CCGGGAAGAGCTCTTGGGACTGAATCTCGAGATTCAGTCCCAAGAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)