EMAIL THIS PAGE TO A FRIEND

LCE2D

late cornified envelope 2D

11 Gene Product Result for
Synonyms: LEP12 SPRL1A
Species: Human LCE2D(353141)
UniProtKB ID: Q5TA82, A1L4M8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178430 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078622 predicted 437
2 SASI_Hs01_00078623 predicted 433
3 SASI_Hs01_00078624 predicted 405
4 SASI_Hs01_00078625 predicted 521
5 SASI_Hs01_00078626 predicted 396
6 SASI_Hs01_00078627 predicted 400
7 SASI_Hs01_00078628 predicted 471
8 SASI_Hs01_00078629 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178430
LCE2D MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 2D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-400s21c1
Sequence:CCGGGAAGAGCTCTGGTACTGAATGCTCGAGCATTCAGTACCAGAGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-433s1c1
Sequence:CCGGCTACAGCCTGATGCTTAACTACTCGAGTAGTTAAGCATCAGGCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-435s21c1
Sequence:CCGGACAGCCTGATGCTTAACTATTCTCGAGAATAGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-458s1c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-320s21c1
Sequence:CCGGCCCGATTGCTGTGAGAGTGAACTCGAGTTCACTCTCACAGCAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178430.2-96s1c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-96s21c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-458s21c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178430
LCE2D MISSION shRNA shRNA Plasmid DNA
late cornified envelope 2D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-400s21c1
Sequence:CCGGGAAGAGCTCTGGTACTGAATGCTCGAGCATTCAGTACCAGAGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-433s1c1
Sequence:CCGGCTACAGCCTGATGCTTAACTACTCGAGTAGTTAAGCATCAGGCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-435s21c1
Sequence:CCGGACAGCCTGATGCTTAACTATTCTCGAGAATAGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-458s1c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-320s21c1
Sequence:CCGGCCCGATTGCTGTGAGAGTGAACTCGAGTTCACTCTCACAGCAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178430.2-96s1c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-96s21c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-458s21c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178430
LCE2D MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 2D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-400s21c1
Sequence:CCGGGAAGAGCTCTGGTACTGAATGCTCGAGCATTCAGTACCAGAGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-433s1c1
Sequence:CCGGCTACAGCCTGATGCTTAACTACTCGAGTAGTTAAGCATCAGGCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-435s21c1
Sequence:CCGGACAGCCTGATGCTTAACTATTCTCGAGAATAGTTAAGCATCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178430.2-458s1c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-320s21c1
Sequence:CCGGCCCGATTGCTGTGAGAGTGAACTCGAGTTCACTCTCACAGCAATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178430.2-96s1c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178430.2-96s21c1
Sequence:CCGGCCAAATGTCCTCCCAAGTGTACTCGAGTACACTTGGGAGGACATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178430.2-458s21c1
Sequence:CCGGCCCTTCCTTTCATTCCACTCACTCGAGTGAGTGGAATGAAAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)