EMAIL THIS PAGE TO A FRIEND

LCE3A

late cornified envelope 3A

25 Gene Product Result for
Synonyms: LEP13
UniProtKB ID: Q5TA76
Gene ID:
Mouse(545548) late cornified envelope 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178431 Rosetta Predictions human pricing
NM_001039594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228642 predicted 34
2 SASI_Hs01_00228643 predicted 36
3 SASI_Hs01_00228644 predicted 46
4 SASI_Hs01_00228645 predicted 156
5 SASI_Hs01_00228646 predicted 173
6 SASI_Hs01_00228647 predicted 227
7 SASI_Hs01_00228649 predicted 173
8 SASI_Hs01_00228650 predicted 171
9 SASI_Hs01_00228651 predicted 138
10 SASI_Hs02_00369664 predicted 148
11 SASI_Hs01_00228648 predicted 43
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083417 predicted 469
2 SASI_Mm01_00083418 predicted 327
3 SASI_Mm01_00083419 predicted 359
4 SASI_Mm01_00083420 predicted 509
5 SASI_Mm01_00083421 predicted 437
6 SASI_Mm01_00083422 predicted 506
7 SASI_Mm01_00083423 predicted 510
8 SASI_Mm01_00083424 predicted 453
9 SASI_Mm01_00083425 predicted 339
10 SASI_Mm01_00083426 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039594
LCE3A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039594.1-338s21c1
Sequence:CCGGCTAACTTGCATCCTGAGTTTGCTCGAGCAAACTCAGGATGCAAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-391s21c1
Sequence:CCGGGCCATGTTGGCTTGTTCTTTCCTCGAGGAAAGAACAAGCCAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-441s21c1
Sequence:CCGGGTGTTCTTGAGCTCTTCTAATCTCGAGATTAGAAGAGCTCAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-407s21c1
Sequence:CCGGCTTTCTTCAGATATCAGAATCCTCGAGGATTCTGATATCTGAAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-371s21c1
Sequence:CCGGTTGGAGTACTGAGCAGTAGTGCTCGAGCACTACTGCTCAGTACTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039594
LCE3A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039594.1-338s21c1
Sequence:CCGGCTAACTTGCATCCTGAGTTTGCTCGAGCAAACTCAGGATGCAAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-391s21c1
Sequence:CCGGGCCATGTTGGCTTGTTCTTTCCTCGAGGAAAGAACAAGCCAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-441s21c1
Sequence:CCGGGTGTTCTTGAGCTCTTCTAATCTCGAGATTAGAAGAGCTCAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-407s21c1
Sequence:CCGGCTTTCTTCAGATATCAGAATCCTCGAGGATTCTGATATCTGAAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-371s21c1
Sequence:CCGGTTGGAGTACTGAGCAGTAGTGCTCGAGCACTACTGCTCAGTACTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039594
LCE3A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039594.1-338s21c1
Sequence:CCGGCTAACTTGCATCCTGAGTTTGCTCGAGCAAACTCAGGATGCAAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-391s21c1
Sequence:CCGGGCCATGTTGGCTTGTTCTTTCCTCGAGGAAAGAACAAGCCAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-441s21c1
Sequence:CCGGGTGTTCTTGAGCTCTTCTAATCTCGAGATTAGAAGAGCTCAAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-407s21c1
Sequence:CCGGCTTTCTTCAGATATCAGAATCCTCGAGGATTCTGATATCTGAAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039594.1-371s21c1
Sequence:CCGGTTGGAGTACTGAGCAGTAGTGCTCGAGCACTACTGCTCAGTACTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178431
LCE3A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-177s21c1
Sequence:CCGGTTGCCGTTGCCAGAGCTCCAACTCGAGTTGGAGCTCTGGCAACGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-53s21c1
Sequence:CCGGCAAAGAGCCCAGCACAGTGTCCTCGAGGACACTGTGCTGGGCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-140s21c1
Sequence:CCGGGCTGCCTGAGTCACCACAGATCTCGAGATCTGTGGTGACTCAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-235s21c1
Sequence:CCGGTCCAGCTGTGGCCACAGTTCTCTCGAGAGAACTGTGGCCACAGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-66s21c1
Sequence:CCGGACAGTGTCTGCCTCCAGCTTCCTCGAGGAAGCTGGAGGCAGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178431
LCE3A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-177s21c1
Sequence:CCGGTTGCCGTTGCCAGAGCTCCAACTCGAGTTGGAGCTCTGGCAACGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-53s21c1
Sequence:CCGGCAAAGAGCCCAGCACAGTGTCCTCGAGGACACTGTGCTGGGCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-140s21c1
Sequence:CCGGGCTGCCTGAGTCACCACAGATCTCGAGATCTGTGGTGACTCAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-235s21c1
Sequence:CCGGTCCAGCTGTGGCCACAGTTCTCTCGAGAGAACTGTGGCCACAGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-66s21c1
Sequence:CCGGACAGTGTCTGCCTCCAGCTTCCTCGAGGAAGCTGGAGGCAGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178431
LCE3A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-177s21c1
Sequence:CCGGTTGCCGTTGCCAGAGCTCCAACTCGAGTTGGAGCTCTGGCAACGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-53s21c1
Sequence:CCGGCAAAGAGCCCAGCACAGTGTCCTCGAGGACACTGTGCTGGGCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-140s21c1
Sequence:CCGGGCTGCCTGAGTCACCACAGATCTCGAGATCTGTGGTGACTCAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-235s21c1
Sequence:CCGGTCCAGCTGTGGCCACAGTTCTCTCGAGAGAACTGTGGCCACAGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178431.1-66s21c1
Sequence:CCGGACAGTGTCTGCCTCCAGCTTCCTCGAGGAAGCTGGAGGCAGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)