EMAIL THIS PAGE TO A FRIEND

LCE3B

late cornified envelope 3B

20 Gene Product Result for
Synonyms: LEP14
UniProtKB ID: Q5TA77
Gene ID:
Mouse(66344) late cornified envelope 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160551 MISSION® esiRNA esiRNA targeting mouse Lce3b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178433 Rosetta Predictions human pricing
NM_025501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190038 predicted 98
2 SASI_Hs01_00190039 predicted 90
3 SASI_Hs01_00190040 predicted 248
4 SASI_Hs01_00190041 predicted 222
5 SASI_Hs01_00190042 predicted 228
6 SASI_Hs01_00190043 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165211 predicted 462
2 SASI_Mm01_00165213 predicted 454
3 SASI_Mm01_00165214 predicted 367
4 SASI_Mm01_00165216 predicted 465
5 SASI_Mm01_00165217 predicted 447
6 SASI_Mm01_00165218 predicted 451
7 SASI_Mm01_00165219 predicted 363
8 SASI_Mm01_00165212 predicted 457
9 SASI_Mm01_00165215 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025501
LCE3B MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-176s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAACCTCGAGGTTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-105s21c1
Sequence:CCGGCCAAGTGTCCCTCTCCAAAGTCTCGAGACTTTGGAGAGGGACACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-388s21c1
Sequence:CCGGAGTCTGGAGGAATCAACATCCCTCGAGGGATGTTGATTCCTCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-356s21c1
Sequence:CCGGTGCTGACCTGGAGCATGATGTCTCGAGACATCATGCTCCAGGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-374s21c1
Sequence:CCGGTGTGGAGACAAGACAGTCTGGCTCGAGCCAGACTGTCTTGTCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025501
LCE3B MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-176s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAACCTCGAGGTTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-105s21c1
Sequence:CCGGCCAAGTGTCCCTCTCCAAAGTCTCGAGACTTTGGAGAGGGACACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-388s21c1
Sequence:CCGGAGTCTGGAGGAATCAACATCCCTCGAGGGATGTTGATTCCTCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-356s21c1
Sequence:CCGGTGCTGACCTGGAGCATGATGTCTCGAGACATCATGCTCCAGGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-374s21c1
Sequence:CCGGTGTGGAGACAAGACAGTCTGGCTCGAGCCAGACTGTCTTGTCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025501
LCE3B MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-176s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAACCTCGAGGTTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-105s21c1
Sequence:CCGGCCAAGTGTCCCTCTCCAAAGTCTCGAGACTTTGGAGAGGGACACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-388s21c1
Sequence:CCGGAGTCTGGAGGAATCAACATCCCTCGAGGGATGTTGATTCCTCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025501.2-356s21c1
Sequence:CCGGTGCTGACCTGGAGCATGATGTCTCGAGACATCATGCTCCAGGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025501.2-374s21c1
Sequence:CCGGTGTGGAGACAAGACAGTCTGGCTCGAGCCAGACTGTCTTGTCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178433
LCE3B MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000244024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-208s21c1
Sequence:CCGGAGCTCCAACTCCTGTGACAGACTCGAGTCTGTCACAGGAGTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-226s21c1
Sequence:CCGGAGAGGCAGTGGTCAGCAAGATCTCGAGATCTTGCTGACCACTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-241s21c1
Sequence:CCGGCAAGATGGTGCCTCCGACTGTCTCGAGACAGTCGGAGGCACCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-68s21c1
Sequence:CCGGCAAAGAGCTCAGCACAGTGTCCTCGAGGACACTGTGCTGAGCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178433
LCE3B MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000244024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-208s21c1
Sequence:CCGGAGCTCCAACTCCTGTGACAGACTCGAGTCTGTCACAGGAGTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-226s21c1
Sequence:CCGGAGAGGCAGTGGTCAGCAAGATCTCGAGATCTTGCTGACCACTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-241s21c1
Sequence:CCGGCAAGATGGTGCCTCCGACTGTCTCGAGACAGTCGGAGGCACCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-68s21c1
Sequence:CCGGCAAAGAGCTCAGCACAGTGTCCTCGAGGACACTGTGCTGAGCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178433
LCE3B MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000244024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-208s21c1
Sequence:CCGGAGCTCCAACTCCTGTGACAGACTCGAGTCTGTCACAGGAGTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-226s21c1
Sequence:CCGGAGAGGCAGTGGTCAGCAAGATCTCGAGATCTTGCTGACCACTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-241s21c1
Sequence:CCGGCAAGATGGTGCCTCCGACTGTCTCGAGACAGTCGGAGGCACCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178433.1-68s21c1
Sequence:CCGGCAAAGAGCTCAGCACAGTGTCCTCGAGGACACTGTGCTGAGCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)