EMAIL THIS PAGE TO A FRIEND

LCE3C

late cornified envelope 3C

20 Gene Product Result for
Synonyms: LEP15 SPRL3A
UniProtKB ID: Q5T5A8, A1L420
Gene ID:
Mouse(94060) late cornified envelope 3C
cow(100295300) late cornified envelope 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178434 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178434 Rosetta Predictions human pricing
NM_033175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051548 predicted 88
2 SASI_Hs01_00051550 predicted 32
3 SASI_Hs01_00051551 predicted 171
4 SASI_Hs01_00051555 predicted 101
5 SASI_Hs01_00051556 predicted 185
6 SASI_Hs01_00051557 predicted 172
7 SASI_Hs02_00369668 predicted 94
8 SASI_Hs01_00051549 predicted 165
9 SASI_Hs02_00369669 predicted 33
10 SASI_Hs01_00051554 predicted 164
11 SASI_Hs01_00051552 predicted 102
12 SASI_Hs01_00051553 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086985 predicted 466
2 SASI_Mm01_00086983 predicted 455
3 SASI_Mm01_00086982 predicted 367
4 SASI_Mm01_00086984 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033175
LCE3C MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033175.3-384s21c1
Sequence:CCGGACAAGACAGTCTGGAGGAATCCTCGAGGATTCCTCCAGACTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-109s21c1
Sequence:CCGGCAAGTGTCCCTCTCCAAAGTGCTCGAGCACTTTGGAGAGGGACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-362s21c1
Sequence:CCGGTGACCTGGAGCATGATGCTGACTCGAGTCAGCATCATGCTCCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-147s21c1
Sequence:CCGGCAAAGAGCACAGCACAGTGTCCTCGAGGACACTGTGCTGTGCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-179s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAGCCTCGAGGCTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033175
LCE3C MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033175.3-384s21c1
Sequence:CCGGACAAGACAGTCTGGAGGAATCCTCGAGGATTCCTCCAGACTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-109s21c1
Sequence:CCGGCAAGTGTCCCTCTCCAAAGTGCTCGAGCACTTTGGAGAGGGACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-362s21c1
Sequence:CCGGTGACCTGGAGCATGATGCTGACTCGAGTCAGCATCATGCTCCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-147s21c1
Sequence:CCGGCAAAGAGCACAGCACAGTGTCCTCGAGGACACTGTGCTGTGCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-179s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAGCCTCGAGGCTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033175
LCE3C MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033175.3-384s21c1
Sequence:CCGGACAAGACAGTCTGGAGGAATCCTCGAGGATTCCTCCAGACTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-109s21c1
Sequence:CCGGCAAGTGTCCCTCTCCAAAGTGCTCGAGCACTTTGGAGAGGGACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-362s21c1
Sequence:CCGGTGACCTGGAGCATGATGCTGACTCGAGTCAGCATCATGCTCCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-147s21c1
Sequence:CCGGCAAAGAGCACAGCACAGTGTCCTCGAGGACACTGTGCTGTGCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033175.3-179s21c1
Sequence:CCGGTCTTCCTGCTGTGCTACAAGCCTCGAGGCTTGTAGCACAGCAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178434
LCE3C MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-174s21c1
Sequence:CCGGGCACTTCAGGTCCCATCAATGCTCGAGCATTGATGGGACCTGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-205s21c1
Sequence:CCGGAGATCCAACTCCTGTGACAGGCTCGAGCCTGTCACAGGAGTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-42s21c1
Sequence:CCGGCAGTTGTCCCTCACCCAAGTGCTCGAGCACTTGGGTGAGGGACAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-99s21c1
Sequence:CCGGCTCTTCTGACTGTGCTCTAAGCTCGAGCTTAGAGCACAGTCAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-139s21c1
Sequence:CCGGAGTTCTGAAAGTGGCTGCTGCCTCGAGGCAGCAGCCACTTTCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178434
LCE3C MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-174s21c1
Sequence:CCGGGCACTTCAGGTCCCATCAATGCTCGAGCATTGATGGGACCTGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-205s21c1
Sequence:CCGGAGATCCAACTCCTGTGACAGGCTCGAGCCTGTCACAGGAGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-42s21c1
Sequence:CCGGCAGTTGTCCCTCACCCAAGTGCTCGAGCACTTGGGTGAGGGACAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-99s21c1
Sequence:CCGGCTCTTCTGACTGTGCTCTAAGCTCGAGCTTAGAGCACAGTCAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-139s21c1
Sequence:CCGGAGTTCTGAAAGTGGCTGCTGCCTCGAGGCAGCAGCCACTTTCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178434
LCE3C MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-174s21c1
Sequence:CCGGGCACTTCAGGTCCCATCAATGCTCGAGCATTGATGGGACCTGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-205s21c1
Sequence:CCGGAGATCCAACTCCTGTGACAGGCTCGAGCCTGTCACAGGAGTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-42s21c1
Sequence:CCGGCAGTTGTCCCTCACCCAAGTGCTCGAGCACTTGGGTGAGGGACAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-99s21c1
Sequence:CCGGCTCTTCTGACTGTGCTCTAAGCTCGAGCTTAGAGCACAGTCAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178434.1-139s21c1
Sequence:CCGGAGTTCTGAAAGTGGCTGCTGCCTCGAGGCAGCAGCCACTTTCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)