EMAIL THIS PAGE TO A FRIEND

LCE3D

late cornified envelope 3D

18 Gene Product Result for
Synonyms: LEP16 SPRL6A SPRL6B
UniProtKB ID: Q9BYE3, Q3MIL1
Gene ID:
Mouse(630994) late cornified envelope 3D
Rat(100361859) late cornified envelope 3D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032563 Rosetta Predictions human pricing
XM_001478579 Rosetta Predictions mouse pricing
XM_904666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134569 predicted 326
2 SASI_Hs01_00134570 predicted 518
3 SASI_Hs01_00134572 predicted 400
4 SASI_Hs01_00134573 predicted 555
5 SASI_Hs01_00134574 predicted 493
6 SASI_Hs01_00134575 predicted 406
7 SASI_Hs01_00134576 predicted 511
8 SASI_Hs01_00134577 predicted 502
9 SASI_Hs01_00134571 predicted 491
10 SASI_Hs01_00134578 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403687 predicted 71
2 SASI_Mm02_00403688 predicted 528
3 SASI_Mm02_00403689 predicted 59
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431078 predicted 464
2 SASI_Mm02_00431079 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032563
LCE3D MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-346s21c1
Sequence:CCGGTGATGCTGAGACAAGCGATTTCTCGAGAAATCGCTTGTCTCAGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-417s21c1
Sequence:CCGGGAGTTCCCAGATACCCTCTTCCTCGAGGAAGAGGGTATCTGGGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-334s21c1
Sequence:CCGGTGACCTGGATCCTGATGCTGACTCGAGTCAGCATCAGGATCCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-125s21c1
Sequence:CCGGCAAAGAGCCCAGTACAGTGTCCTCGAGGACACTGTACTGGGCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-402s21c1
Sequence:CCGGCCCATCTTGATGCATGAGTTCCTCGAGGAACTCATGCATCAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032563
LCE3D MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-346s21c1
Sequence:CCGGTGATGCTGAGACAAGCGATTTCTCGAGAAATCGCTTGTCTCAGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-417s21c1
Sequence:CCGGGAGTTCCCAGATACCCTCTTCCTCGAGGAAGAGGGTATCTGGGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-334s21c1
Sequence:CCGGTGACCTGGATCCTGATGCTGACTCGAGTCAGCATCAGGATCCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-125s21c1
Sequence:CCGGCAAAGAGCCCAGTACAGTGTCCTCGAGGACACTGTACTGGGCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-402s21c1
Sequence:CCGGCCCATCTTGATGCATGAGTTCCTCGAGGAACTCATGCATCAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032563
LCE3D MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-346s21c1
Sequence:CCGGTGATGCTGAGACAAGCGATTTCTCGAGAAATCGCTTGTCTCAGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-417s21c1
Sequence:CCGGGAGTTCCCAGATACCCTCTTCCTCGAGGAAGAGGGTATCTGGGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-334s21c1
Sequence:CCGGTGACCTGGATCCTGATGCTGACTCGAGTCAGCATCAGGATCCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032563.1-125s21c1
Sequence:CCGGCAAAGAGCCCAGTACAGTGTCCTCGAGGACACTGTACTGGGCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032563.1-402s21c1
Sequence:CCGGCCCATCTTGATGCATGAGTTCCTCGAGGAACTCATGCATCAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)