EMAIL THIS PAGE TO A FRIEND

LCE3E

late cornified envelope 3E

22 Gene Product Result for
Synonyms: LEP17
UniProtKB ID: Q5T5B0, A2RRM6
Gene ID:
Mouse(69514) late cornified envelope 3E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178435 Rosetta Predictions human pricing
XM_001478585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206664 predicted 352
2 SASI_Hs01_00206665 predicted 349
3 SASI_Hs01_00206666 predicted 325
4 SASI_Hs01_00206669 predicted 416
5 SASI_Hs01_00206670 predicted 556
6 SASI_Hs01_00206671 predicted 418
7 SASI_Hs01_00206667 predicted 357
8 SASI_Hs01_00206668 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403720 predicted 455
2 SASI_Mm02_00403721 predicted 459
3 SASI_Mm02_00403722 predicted 458
4 SASI_Mm02_00403723 predicted 459
5 SASI_Mm02_00403724 predicted 444
6 SASI_Mm02_00403725 predicted 472
7 SASI_Mm02_00403726 predicted 26
8 SASI_Mm02_00403727 predicted 638
9 SASI_Mm02_00403728 predicted 18
10 SASI_Mm02_00403729 predicted 95
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178435
LCE3E MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 3E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-378s21c1
Sequence:CCGGAGAATCCCAAGAGGCCAAGAACTCGAGTTCTTGGCCTCTTGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-359s21c1
Sequence:CCGGGCGATCTTTGGAGGAAACAAGCTCGAGCTTGTTTCCTCCAAAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-348s21c1
Sequence:CCGGTGCTGAGACAAGCGATCTTTGCTCGAGCAAAGATCGCTTGTCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-410s21c1
Sequence:CCGGGACGCATGCCTTCCCATATACCTCGAGGTATATGGGAAGGCATGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-336s21c1
Sequence:CCGGTCCAGATCCTGATGCTGAGACCTCGAGGTCTCAGCATCAGGATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178435
LCE3E MISSION shRNA shRNA Plasmid DNA
late cornified envelope 3E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-378s21c1
Sequence:CCGGAGAATCCCAAGAGGCCAAGAACTCGAGTTCTTGGCCTCTTGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-359s21c1
Sequence:CCGGGCGATCTTTGGAGGAAACAAGCTCGAGCTTGTTTCCTCCAAAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-348s21c1
Sequence:CCGGTGCTGAGACAAGCGATCTTTGCTCGAGCAAAGATCGCTTGTCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-410s21c1
Sequence:CCGGGACGCATGCCTTCCCATATACCTCGAGGTATATGGGAAGGCATGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-336s21c1
Sequence:CCGGTCCAGATCCTGATGCTGAGACCTCGAGGTCTCAGCATCAGGATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178435
LCE3E MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 3E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-378s21c1
Sequence:CCGGAGAATCCCAAGAGGCCAAGAACTCGAGTTCTTGGCCTCTTGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-359s21c1
Sequence:CCGGGCGATCTTTGGAGGAAACAAGCTCGAGCTTGTTTCCTCCAAAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-348s21c1
Sequence:CCGGTGCTGAGACAAGCGATCTTTGCTCGAGCAAAGATCGCTTGTCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-410s21c1
Sequence:CCGGGACGCATGCCTTCCCATATACCTCGAGGTATATGGGAAGGCATGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178435.2-336s21c1
Sequence:CCGGTCCAGATCCTGATGCTGAGACCTCGAGGTCTCAGCATCAGGATCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)