EMAIL THIS PAGE TO A FRIEND

Lce3f

12 Gene Product Result for
Species: Mouse Lce3f(69520)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188731 MISSION® esiRNA targeting mouse Lce3f mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107486 predicted 357
2 SASI_Mm01_00107489 predicted 359
3 SASI_Mm01_00107487 predicted 351
4 SASI_Mm01_00107488 predicted 349
5 SASI_Mm01_00107490 predicted 357
6 SASI_Mm01_00107491 predicted 449
7 SASI_Mm01_00107492 predicted 517
8 SASI_Mm01_00107493 predicted 563
9 SASI_Mm01_00107494 predicted 418
10 SASI_Mm02_00287549 predicted 493
11 SASI_Mm01_00107495 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018079
Lce3f MISSION shRNA Bacterial Glycerol Stock
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-407s1c1
Sequence:CCGGCTCAAATGTTCAGTCCTCTTTCTCGAGAAAGAGGACTGAACATTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-366s1c1
Sequence:CCGGGCAATTGGGAAAGAAACACTACTCGAGTAGTGTTTCTTTCCCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-440s1c1
Sequence:CCGGGTCTTCTTTAAGTGCTGAGATCTCGAGATCTCAGCACTTAAAGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-461s1c1
Sequence:CCGGGTTTCCCAAGAGAGCTCAGATCTCGAGATCTGAGCTCTCTTGGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-367s1c1
Sequence:CCGGCAATTGGGAAAGAAACACTATCTCGAGATAGTGTTTCTTTCCCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-360s1c1
Sequence:CCGGGACAGTGCAATTGGGAAAGAACTCGAGTTCTTTCCCAATTGCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018079
Lce3f MISSION shRNA shRNA Plasmid DNA
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-407s1c1
Sequence:CCGGCTCAAATGTTCAGTCCTCTTTCTCGAGAAAGAGGACTGAACATTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-366s1c1
Sequence:CCGGGCAATTGGGAAAGAAACACTACTCGAGTAGTGTTTCTTTCCCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-440s1c1
Sequence:CCGGGTCTTCTTTAAGTGCTGAGATCTCGAGATCTCAGCACTTAAAGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-461s1c1
Sequence:CCGGGTTTCCCAAGAGAGCTCAGATCTCGAGATCTGAGCTCTCTTGGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-367s1c1
Sequence:CCGGCAATTGGGAAAGAAACACTATCTCGAGATAGTGTTTCTTTCCCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-360s1c1
Sequence:CCGGGACAGTGCAATTGGGAAAGAACTCGAGTTCTTTCCCAATTGCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018079
Lce3f MISSION shRNA Lentiviral Transduction Particles
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-407s1c1
Sequence:CCGGCTCAAATGTTCAGTCCTCTTTCTCGAGAAAGAGGACTGAACATTTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-366s1c1
Sequence:CCGGGCAATTGGGAAAGAAACACTACTCGAGTAGTGTTTCTTTCCCAATTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-440s1c1
Sequence:CCGGGTCTTCTTTAAGTGCTGAGATCTCGAGATCTCAGCACTTAAAGAAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-461s1c1
Sequence:CCGGGTTTCCCAAGAGAGCTCAGATCTCGAGATCTGAGCTCTCTTGGGAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-367s1c1
Sequence:CCGGCAATTGGGAAAGAAACACTATCTCGAGATAGTGTTTCTTTCCCAATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018079.1-360s1c1
Sequence:CCGGGACAGTGCAATTGGGAAAGAACTCGAGTTCTTTCCCAATTGCACTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???