EMAIL THIS PAGE TO A FRIEND

LCE4A

late cornified envelope 4A

15 Gene Product Result for
Synonyms: LEP8 SPRL4A
Species: Human LCE4A(199834)
UniProtKB ID: Q5TA78, Q14D97
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178356 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033428 predicted 103
2 SASI_Hs01_00033429 predicted 240
3 SASI_Hs01_00033431 predicted 243
4 SASI_Hs02_00369645 predicted 337
5 SASI_Hs02_00369646 predicted 319
6 SASI_Hs02_00369647 predicted 342
7 SASI_Hs01_00033433 predicted 249
8 SASI_Hs02_00369648 predicted 324
9 SASI_Hs02_00369649 predicted 345
10 SASI_Hs01_00033430 predicted 100
11 SASI_Hs01_00033432 predicted 74
12 SASI_Hs01_00033434 predicted 83
13 SASI_Hs01_00033435 predicted 90
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178356
LCE4A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 4A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-101s21c1
Sequence:CCGGATGTCCCTCAAAGTGTGCATCCTCGAGGATGCACACTTTGAGGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-119s21c1
Sequence:CCGGATCCTCATGCCCACCTCCAATCTCGAGATTGGAGGTGGGCATGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-109s21c1
Sequence:CCGGCAAAGTGTGCATCCTCATGCCCTCGAGGGCATGAGGATGCACACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-208s21c1
Sequence:CCGGTGAGCCACCACAGACACCATACTCGAGTATGGTGTCTGTGGTGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-217s21c1
Sequence:CCGGACAGACACCATAGGTCCCACTCTCGAGAGTGGGACCTATGGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178356
LCE4A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 4A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-101s21c1
Sequence:CCGGATGTCCCTCAAAGTGTGCATCCTCGAGGATGCACACTTTGAGGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-119s21c1
Sequence:CCGGATCCTCATGCCCACCTCCAATCTCGAGATTGGAGGTGGGCATGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-109s21c1
Sequence:CCGGCAAAGTGTGCATCCTCATGCCCTCGAGGGCATGAGGATGCACACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-208s21c1
Sequence:CCGGTGAGCCACCACAGACACCATACTCGAGTATGGTGTCTGTGGTGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-217s21c1
Sequence:CCGGACAGACACCATAGGTCCCACTCTCGAGAGTGGGACCTATGGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178356
LCE4A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 4A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-101s21c1
Sequence:CCGGATGTCCCTCAAAGTGTGCATCCTCGAGGATGCACACTTTGAGGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-119s21c1
Sequence:CCGGATCCTCATGCCCACCTCCAATCTCGAGATTGGAGGTGGGCATGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-109s21c1
Sequence:CCGGCAAAGTGTGCATCCTCATGCCCTCGAGGGCATGAGGATGCACACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-208s21c1
Sequence:CCGGTGAGCCACCACAGACACCATACTCGAGTATGGTGTCTGTGGTGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178356.2-217s21c1
Sequence:CCGGACAGACACCATAGGTCCCACTCTCGAGAGTGGGACCTATGGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)