EMAIL THIS PAGE TO A FRIEND

LCE6A

late cornified envelope 6A

27 Gene Product Result for
Synonyms: C1orf44
UniProtKB ID: A0A183
Gene ID:
Mouse(78382) late cornified envelope 6A
Rat(100361652) late cornified envelope 6A
sheep(101122647) late cornified envelope 6A
domestic guinea pig(101787830) late cornified envelope 6A
naked mole-rat(101726779) late cornified envelope 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128600
LCE6A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 6A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-289s21c1
Sequence:CCGGCCCATTCAGAAGGTTGTCATTCTCGAGAATGACAACCTTCTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-326s21c1
Sequence:CCGGTGAGGTTCAGAAGCCTAGGAGCTCGAGCTCCTAGGCTTCTGAACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128600.1-466s21c1
Sequence:CCGGCCCACCTTTGGGTACTAATTCCTCGAGGAATTAGTACCCAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-259s21c1
Sequence:CCGGTAGCTCCCTACTCGACTCCTTCTCGAGAAGGAGTCGAGTAGGGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-378s21c1
Sequence:CCGGGGCACAACCTACCACTGCAAACTCGAGTTTGCAGTGGTAGGTTGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128600
LCE6A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 6A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-289s21c1
Sequence:CCGGCCCATTCAGAAGGTTGTCATTCTCGAGAATGACAACCTTCTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-326s21c1
Sequence:CCGGTGAGGTTCAGAAGCCTAGGAGCTCGAGCTCCTAGGCTTCTGAACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128600.1-466s21c1
Sequence:CCGGCCCACCTTTGGGTACTAATTCCTCGAGGAATTAGTACCCAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-259s21c1
Sequence:CCGGTAGCTCCCTACTCGACTCCTTCTCGAGAAGGAGTCGAGTAGGGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-378s21c1
Sequence:CCGGGGCACAACCTACCACTGCAAACTCGAGTTTGCAGTGGTAGGTTGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128600
LCE6A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 6A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-289s21c1
Sequence:CCGGCCCATTCAGAAGGTTGTCATTCTCGAGAATGACAACCTTCTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-326s21c1
Sequence:CCGGTGAGGTTCAGAAGCCTAGGAGCTCGAGCTCCTAGGCTTCTGAACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128600.1-466s21c1
Sequence:CCGGCCCACCTTTGGGTACTAATTCCTCGAGGAATTAGTACCCAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-259s21c1
Sequence:CCGGTAGCTCCCTACTCGACTCCTTCTCGAGAAGGAGTCGAGTAGGGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128600.1-378s21c1
Sequence:CCGGGGCACAACCTACCACTGCAAACTCGAGTTTGCAGTGGTAGGTTGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)