EMAIL THIS PAGE TO A FRIEND

LCLAT1

lysocardiolipin acyltransferase 1

212 Gene Product Result for
Synonyms: 1AGPAT8 AGPAT8 ALCAT1 HSRG1849 LYCAT UNQ1849
UniProtKB ID: Q6UWP7, A6H8Z7, Q8N1Q7
Gene ID:
Mouse(225010) lysocardiolipin acyltransferase 1
Rat(362702) lysocardiolipin acyltransferase 1
chicken(421303) lysocardiolipin acyltransferase 1
dog(483023) lysocardiolipin acyltransferase 1
domestic cat(101090183) lysocardiolipin acyltransferase 1
cow(520912) lysocardiolipin acyltransferase 1
Horse(100070805) lysocardiolipin acyltransferase 1
sheep(101103884) lysocardiolipin acyltransferase 1
Domestic Rabbit(100345148) lysocardiolipin acyltransferase 1
domestic guinea pig(100730097) lysocardiolipin acyltransferase 1
naked mole-rat(101705833) lysocardiolipin acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002257 Rosetta Predictions human pricing
NM_182551 Rosetta Predictions human pricing
XM_001060474 Rosetta Predictions rat pricing
XM_343020 Rosetta Predictions rat pricing
NM_001081071 Rosetta Predictions mouse pricing
XM_128781 Rosetta Predictions mouse pricing
XM_897895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072520 predicted 748
2 SASI_Hs01_00072521 predicted 543
3 SASI_Hs01_00072522 predicted 1074
4 SASI_Hs01_00072523 predicted 694
5 SASI_Hs01_00072524 predicted 990
6 SASI_Hs01_00072525 predicted 994
7 SASI_Hs01_00072526 predicted 398
8 SASI_Hs01_00072527 predicted 744
9 SASI_Hs01_00072528 predicted 1073
10 SASI_Hs01_00072529 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198569 predicted 954
2 SASI_Hs01_00198570 predicted 744
3 SASI_Hs01_00198571 predicted 1281
4 SASI_Hs01_00198572 predicted 901
5 SASI_Hs01_00198573 predicted 1192
6 SASI_Hs01_00198574 predicted 1203
7 SASI_Hs01_00198575 predicted 598
8 SASI_Hs01_00198576 predicted 947
9 SASI_Hs01_00198577 predicted 1276
10 SASI_Hs01_00198578 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296630 predicted 1331
2 SASI_Rn02_00296631 predicted 464
3 SASI_Rn02_00296632 predicted 510
4 SASI_Rn02_00296633 predicted 979
5 SASI_Rn02_00296634 predicted 1249
6 SASI_Rn02_00296635 predicted 745
7 SASI_Rn02_00296636 predicted 733
8 SASI_Rn02_00296637 predicted 1045
9 SASI_Rn02_00296638 predicted 355
10 SASI_Rn02_00296639 predicted 191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395201 predicted 460
2 SASI_Rn02_00395202 predicted 496
3 SASI_Rn02_00395203 predicted 512
4 SASI_Rn02_00395204 predicted 411
5 SASI_Rn02_00395205 predicted 489
6 SASI_Rn02_00395206 predicted 459
7 SASI_Rn02_00395207 predicted 333
8 SASI_Rn02_00395208 predicted 354
9 SASI_Rn02_00395209 predicted 557
10 SASI_Rn02_00395210 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294891 predicted 1393
2 SASI_Mm02_00294892 predicted 551
3 SASI_Mm02_00294893 predicted 1306
4 SASI_Mm02_00294894 predicted 562
5 SASI_Mm02_00294895 predicted 1348
6 SASI_Mm02_00294896 predicted 767
7 SASI_Mm02_00294897 predicted 1289
8 SASI_Mm02_00294898 predicted 731
9 SASI_Mm02_00294899 predicted 273
10 SASI_Mm02_00294900 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216275 predicted 1405
2 SASI_Mm01_00216276 predicted 555
3 SASI_Mm01_00216277 predicted 1312
4 SASI_Mm01_00216278 predicted 562
5 SASI_Mm01_00216279 predicted 1362
6 SASI_Mm01_00216280 predicted 1053
7 SASI_Mm01_00216281 predicted 768
8 SASI_Mm01_00216282 predicted 1291
9 SASI_Mm01_00216283 predicted 733
10 SASI_Mm01_00216284 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208942 predicted 1374
2 SASI_Mm01_00208943 predicted 542
3 SASI_Mm01_00208944 predicted 1289
4 SASI_Mm01_00208945 predicted 538
5 SASI_Mm01_00208946 predicted 1335
6 SASI_Mm01_00208947 predicted 1026
7 SASI_Mm01_00208948 predicted 752
8 SASI_Mm01_00208949 predicted 1272
9 SASI_Mm01_00208950 predicted 714
10 SASI_Mm01_00208951 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182551
VALIDATED
LCLAT1 MISSION shRNA Bacterial Glycerol Stock
lysocardiolipin acyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-608s21c1
Sequence:CCGGGAATTGCCTGATGCGATATAGCTCGAGCTATATCGCATCAGGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-705s1c1
Sequence:CCGGGCTGCCTATATCTTCATTCATCTCGAGATGAATGAAGATATAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1239s1c1
Sequence:CCGGGTGGTCAAATTGCTCTCTATACTCGAGTATAGAGAGCAATTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1310s1c1
Sequence:CCGGCAGTCTTGTTAAGTGGTATTTCTCGAGAAATACCACTTAACAAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-313s1c1
Sequence:CCGGGCTTTGGAATCATGGTGTCATCTCGAGATGACACCATGATTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-252s1c1
Sequence:CCGGTGGTCAATTAACGAGGCAGTTCTCGAGAACTGCCTCGTTAATTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-985s21c1
Sequence:CCGGTGGCGTATCCTCACAACATTCCTCGAGGAATGTTGTGAGGATACGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-1059s21c1
Sequence:CCGGCACGTCCACCGGTATCCAATACTCGAGTATTGGATACCGGTGGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182551
VALIDATED
LCLAT1 MISSION shRNA shRNA Plasmid DNA
lysocardiolipin acyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-608s21c1
Sequence:CCGGGAATTGCCTGATGCGATATAGCTCGAGCTATATCGCATCAGGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-705s1c1
Sequence:CCGGGCTGCCTATATCTTCATTCATCTCGAGATGAATGAAGATATAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1239s1c1
Sequence:CCGGGTGGTCAAATTGCTCTCTATACTCGAGTATAGAGAGCAATTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1310s1c1
Sequence:CCGGCAGTCTTGTTAAGTGGTATTTCTCGAGAAATACCACTTAACAAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-313s1c1
Sequence:CCGGGCTTTGGAATCATGGTGTCATCTCGAGATGACACCATGATTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-252s1c1
Sequence:CCGGTGGTCAATTAACGAGGCAGTTCTCGAGAACTGCCTCGTTAATTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-985s21c1
Sequence:CCGGTGGCGTATCCTCACAACATTCCTCGAGGAATGTTGTGAGGATACGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-1059s21c1
Sequence:CCGGCACGTCCACCGGTATCCAATACTCGAGTATTGGATACCGGTGGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182551
VALIDATED
LCLAT1 MISSION shRNA Lentiviral Transduction Particles
lysocardiolipin acyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-608s21c1
Sequence:CCGGGAATTGCCTGATGCGATATAGCTCGAGCTATATCGCATCAGGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-705s1c1
Sequence:CCGGGCTGCCTATATCTTCATTCATCTCGAGATGAATGAAGATATAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1239s1c1
Sequence:CCGGGTGGTCAAATTGCTCTCTATACTCGAGTATAGAGAGCAATTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-1310s1c1
Sequence:CCGGCAGTCTTGTTAAGTGGTATTTCTCGAGAAATACCACTTAACAAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182551.2-313s1c1
Sequence:CCGGGCTTTGGAATCATGGTGTCATCTCGAGATGACACCATGATTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182551.2-252s1c1
Sequence:CCGGTGGTCAATTAACGAGGCAGTTCTCGAGAACTGCCTCGTTAATTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-985s21c1
Sequence:CCGGTGGCGTATCCTCACAACATTCCTCGAGGAATGTTGTGAGGATACGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182551.3-1059s21c1
Sequence:CCGGCACGTCCACCGGTATCCAATACTCGAGTATTGGATACCGGTGGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081071
LCLAT1 MISSION shRNA Bacterial Glycerol Stock
lysocardiolipin acyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-295s21c1
Sequence:CCGGTGTCGTGGTATCGCTGGATTACTCGAGTAATCCAGCGATACCACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081071.1-3545s21c1
Sequence:CCGGTATAGTAGTTGTGGGTTATTTCTCGAGAAATAACCCACAACTACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1175s21c1
Sequence:CCGGCAGCCCTGTTCGGTGGTATTTCTCGAGAAATACCACCGAACAGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1149s21c1
Sequence:CCGGGCAATGTGCCTGCTCATATATCTCGAGATATATGAGCAGGCACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-559s21c1
Sequence:CCGGCCATGCAAGTTGCGGCCTTTACTCGAGTAAAGGCCGCAACTTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081071
LCLAT1 MISSION shRNA shRNA Plasmid DNA
lysocardiolipin acyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-295s21c1
Sequence:CCGGTGTCGTGGTATCGCTGGATTACTCGAGTAATCCAGCGATACCACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081071.1-3545s21c1
Sequence:CCGGTATAGTAGTTGTGGGTTATTTCTCGAGAAATAACCCACAACTACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1175s21c1
Sequence:CCGGCAGCCCTGTTCGGTGGTATTTCTCGAGAAATACCACCGAACAGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1149s21c1
Sequence:CCGGGCAATGTGCCTGCTCATATATCTCGAGATATATGAGCAGGCACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-559s21c1
Sequence:CCGGCCATGCAAGTTGCGGCCTTTACTCGAGTAAAGGCCGCAACTTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081071
LCLAT1 MISSION shRNA Lentiviral Transduction Particles
lysocardiolipin acyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-295s21c1
Sequence:CCGGTGTCGTGGTATCGCTGGATTACTCGAGTAATCCAGCGATACCACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081071.1-3545s21c1
Sequence:CCGGTATAGTAGTTGTGGGTTATTTCTCGAGAAATAACCCACAACTACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1175s21c1
Sequence:CCGGCAGCCCTGTTCGGTGGTATTTCTCGAGAAATACCACCGAACAGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-1149s21c1
Sequence:CCGGGCAATGTGCCTGCTCATATATCTCGAGATATATGAGCAGGCACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081071.1-559s21c1
Sequence:CCGGCCATGCAAGTTGCGGCCTTTACTCGAGTAAAGGCCGCAACTTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)