EMAIL THIS PAGE TO A FRIEND

LCMT1

leucine carboxyl methyltransferase 1

102 Gene Product Result for
Synonyms: LCMT PPMT1
Gene ID:
Human(51451) Summary: LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]
Mouse(30949) leucine carboxyl methyltransferase 1
Rat(361643) leucine carboxyl methyltransferase 1
domestic guinea pig(100719646) leucine carboxyl methyltransferase 1
naked mole-rat(101699863) leucine carboxyl methyltransferase 1
sheep(101107755) leucine carboxyl methyltransferase 1
Zebrafish(447907) leucine carboxyl methyltransferase 1
chicken(416565) leucine carboxyl methyltransferase 1
cow(618021) leucine carboxyl methyltransferase 1
domestic cat(101087959) leucine carboxyl methyltransferase 1
dog(608360) leucine carboxyl methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016015 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032391 Rosetta Predictions human pricing
NM_016309 Rosetta Predictions human pricing
NM_199405 Rosetta Predictions rat pricing
NM_025304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220912 predicted 954
2 SASI_Hs01_00220913 predicted 934
3 SASI_Hs02_00307932 predicted 931
4 SASI_Hs02_00307933 predicted 794
5 SASI_Hs01_00220918 predicted 279
6 SASI_Hs01_00220919 predicted 300
7 SASI_Hs02_00307934 predicted 298
8 SASI_Hs02_00307935 predicted 293
9 SASI_Hs02_00307936 predicted 863
10 SASI_Hs02_00307937 predicted 967
11 SASI_Hs01_00220914 predicted 981
12 SASI_Hs01_00220915 predicted 291
13 SASI_Hs01_00220916 predicted 985
14 SASI_Hs01_00220917 predicted 319
15 SASI_Hs01_00220920 predicted 771
16 SASI_Hs01_00220921 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062905 predicted 1126
2 SASI_Hs01_00062906 predicted 1099
3 SASI_Hs02_00349237 predicted 1098
4 SASI_Hs02_00349238 predicted 959
5 SASI_Hs01_00062911 predicted 280
6 SASI_Hs01_00062912 predicted 298
7 SASI_Hs02_00349239 predicted 290
8 SASI_Hs02_00349240 predicted 291
9 SASI_Hs02_00349241 predicted 1023
10 SASI_Hs02_00349242 predicted 1132
11 SASI_Hs01_00062907 predicted 1138
12 SASI_Hs01_00062908 predicted 295
13 SASI_Hs01_00062909 predicted 1153
14 SASI_Hs01_00062910 predicted 320
15 SASI_Hs01_00062913 predicted 929
16 SASI_Hs01_00062914 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073455 predicted 264
2 SASI_Rn01_00073456 predicted 973
3 SASI_Rn01_00073457 predicted 411
4 SASI_Rn01_00073459 predicted 514
5 SASI_Rn01_00073460 predicted 1087
6 SASI_Rn01_00073461 predicted 379
7 SASI_Rn01_00073462 predicted 873
8 SASI_Rn01_00073464 predicted 543
9 SASI_Rn02_00270232 predicted 471
10 SASI_Rn02_00270233 predicted 465
11 SASI_Rn01_00073458 predicted 651
12 SASI_Rn01_00073463 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128388 predicted 312
2 SASI_Mm01_00128389 predicted 958
3 SASI_Mm01_00128390 predicted 1026
4 SASI_Mm01_00128391 predicted 925
5 SASI_Mm01_00128392 predicted 749
6 SASI_Mm01_00128393 predicted 733
7 SASI_Mm01_00128394 predicted 1136
8 SASI_Mm01_00128395 predicted 725
9 SASI_Mm01_00128396 predicted 303
10 SASI_Mm01_00128397 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016309
VALIDATED
LCMT1 MISSION shRNA Bacterial Glycerol Stock
leucine carboxyl methyltransferase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000296965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-528s21c1
Sequence:CCGGCCAATGATTGTCACGAGAAAGCTCGAGCTTTCTCGTGACAATCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-1142s21c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-347s21c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-642s21c1
Sequence:CCGGTCAAAGAGATATGCCGTTATTCTCGAGAATAACGGCATATCTCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016309
VALIDATED
LCMT1 MISSION shRNA shRNA Plasmid DNA
leucine carboxyl methyltransferase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000296965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-528s21c1
Sequence:CCGGCCAATGATTGTCACGAGAAAGCTCGAGCTTTCTCGTGACAATCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-1142s21c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-347s21c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-642s21c1
Sequence:CCGGTCAAAGAGATATGCCGTTATTCTCGAGAATAACGGCATATCTCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016309
VALIDATED
LCMT1 MISSION shRNA Lentiviral Transduction Particles
leucine carboxyl methyltransferase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000296965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-528s21c1
Sequence:CCGGCCAATGATTGTCACGAGAAAGCTCGAGCTTTCTCGTGACAATCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-1142s21c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016309.2-347s21c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016309.2-642s21c1
Sequence:CCGGTCAAAGAGATATGCCGTTATTCTCGAGAATAACGGCATATCTCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025304
VALIDATED
LCMT1 MISSION shRNA Bacterial Glycerol Stock
leucine carboxyl methyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-467s21c1
Sequence:CCGGTACCACCTTCTGGAAATTAAACTCGAGTTTAATTTCCAGAAGGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-387s1c1
Sequence:CCGGGGTGTCAGTCAGCTTATTAAACTCGAGTTTAATAAGCTGACTGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-293s1c1
Sequence:CCGGCTACTGGCATGATCCGTACATCTCGAGATGTACGGATCATGCCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-1137s1c1
Sequence:CCGGGAGCTTGGTTTGAAGGAGATACTCGAGTATCTCCTTCAAACCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-492s1c1
Sequence:CCGGGAAGGTCTTCTCCCAAATAAACTCGAGTTTATTTGGGAGAAGACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025304.3-1192s21c1
Sequence:CCGGGAAGGTGAAGGCTCTAGCTAACTCGAGTTAGCTAGAGCCTTCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-490s21c1
Sequence:CCGGATGAAGGTCTTCTCCCAAATACTCGAGTATTTGGGAGAAGACCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-386s21c1
Sequence:CCGGTGGTGTCAGTCAGCTTATTAACTCGAGTTAATAAGCTGACTGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-820s21c1
Sequence:CCGGTTGAGACAGCCATGTTCATAACTCGAGTTATGAACATGGCTGTCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025304
VALIDATED
LCMT1 MISSION shRNA shRNA Plasmid DNA
leucine carboxyl methyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-467s21c1
Sequence:CCGGTACCACCTTCTGGAAATTAAACTCGAGTTTAATTTCCAGAAGGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-387s1c1
Sequence:CCGGGGTGTCAGTCAGCTTATTAAACTCGAGTTTAATAAGCTGACTGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-293s1c1
Sequence:CCGGCTACTGGCATGATCCGTACATCTCGAGATGTACGGATCATGCCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-1137s1c1
Sequence:CCGGGAGCTTGGTTTGAAGGAGATACTCGAGTATCTCCTTCAAACCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-492s1c1
Sequence:CCGGGAAGGTCTTCTCCCAAATAAACTCGAGTTTATTTGGGAGAAGACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025304.3-1192s21c1
Sequence:CCGGGAAGGTGAAGGCTCTAGCTAACTCGAGTTAGCTAGAGCCTTCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-490s21c1
Sequence:CCGGATGAAGGTCTTCTCCCAAATACTCGAGTATTTGGGAGAAGACCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-386s21c1
Sequence:CCGGTGGTGTCAGTCAGCTTATTAACTCGAGTTAATAAGCTGACTGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-820s21c1
Sequence:CCGGTTGAGACAGCCATGTTCATAACTCGAGTTATGAACATGGCTGTCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025304
VALIDATED
LCMT1 MISSION shRNA Lentiviral Transduction Particles
leucine carboxyl methyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-467s21c1
Sequence:CCGGTACCACCTTCTGGAAATTAAACTCGAGTTTAATTTCCAGAAGGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-387s1c1
Sequence:CCGGGGTGTCAGTCAGCTTATTAAACTCGAGTTTAATAAGCTGACTGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-293s1c1
Sequence:CCGGCTACTGGCATGATCCGTACATCTCGAGATGTACGGATCATGCCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-1137s1c1
Sequence:CCGGGAGCTTGGTTTGAAGGAGATACTCGAGTATCTCCTTCAAACCAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025304.3-492s1c1
Sequence:CCGGGAAGGTCTTCTCCCAAATAAACTCGAGTTTATTTGGGAGAAGACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025304.3-1192s21c1
Sequence:CCGGGAAGGTGAAGGCTCTAGCTAACTCGAGTTAGCTAGAGCCTTCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-490s21c1
Sequence:CCGGATGAAGGTCTTCTCCCAAATACTCGAGTATTTGGGAGAAGACCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025304.3-386s21c1
Sequence:CCGGTGGTGTCAGTCAGCTTATTAACTCGAGTTAATAAGCTGACTGACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025304.3-820s21c1
Sequence:CCGGTTGAGACAGCCATGTTCATAACTCGAGTTATGAACATGGCTGTCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016015
LCMT1 MISSION shRNA Bacterial Glycerol Stock
leucine carboxyl methyltransferase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-932s1c1
Sequence:CCGGGCCATGTTCATAAACTACGAACTCGAGTTCGTAGTTTATGAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1249s1c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-421s1c1
Sequence:CCGGGCACTTTGTGAGACTGTCTAACTCGAGTTAGACAGTCTCACAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1099s1c1
Sequence:CCGGCGTCGACATGATGGAGTTGTACTCGAGTACAACTCCATCATGTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-454s1c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016015
LCMT1 MISSION shRNA shRNA Plasmid DNA
leucine carboxyl methyltransferase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-932s1c1
Sequence:CCGGGCCATGTTCATAAACTACGAACTCGAGTTCGTAGTTTATGAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1249s1c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-421s1c1
Sequence:CCGGGCACTTTGTGAGACTGTCTAACTCGAGTTAGACAGTCTCACAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1099s1c1
Sequence:CCGGCGTCGACATGATGGAGTTGTACTCGAGTACAACTCCATCATGTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-454s1c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016015
LCMT1 MISSION shRNA Lentiviral Transduction Particles
leucine carboxyl methyltransferase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-932s1c1
Sequence:CCGGGCCATGTTCATAAACTACGAACTCGAGTTCGTAGTTTATGAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1249s1c1
Sequence:CCGGGCTGAAGGAGATAACTTATTACTCGAGTAATAAGTTATCTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-421s1c1
Sequence:CCGGGCACTTTGTGAGACTGTCTAACTCGAGTTAGACAGTCTCACAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-1099s1c1
Sequence:CCGGCGTCGACATGATGGAGTTGTACTCGAGTACAACTCCATCATGTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016015.2-454s1c1
Sequence:CCGGCCCTGAAATCAACAGAGGATACTCGAGTATCCTCTGTTGATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)